Incidental Mutation 'R8125:Pard3b'
ID 631678
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Name par-3 family cell polarity regulator beta
Synonyms PAR3L, PAR3B, 1810008K04Rik, 2010002N16Rik, PAR3beta, Als2cr19, 2810455B10Rik
MMRRC Submission 067554-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8125 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 61677983-62681443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61807143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 53 (Y53H)
Ref Sequence ENSEMBL: ENSMUSP00000074837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
AlphaFold Q9CSB4
PDB Structure Solution structure of PDZ domain in protein XP_110852 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000046673
AA Change: Y53H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: Y53H

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075374
AA Change: Y53H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: Y53H

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094906
AA Change: Y53H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: Y53H

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Meta Mutation Damage Score 0.1430 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,608,709 (GRCm39) T143K probably benign Het
4933434E20Rik T A 3: 89,972,818 (GRCm39) V74D possibly damaging Het
Acot11 C T 4: 106,617,277 (GRCm39) probably null Het
Adam20 A T 8: 41,247,973 (GRCm39) I28L probably benign Het
Adamtsl3 A G 7: 82,099,541 (GRCm39) probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak C T 19: 8,989,240 (GRCm39) A3508V possibly damaging Het
Arhgap20 T C 9: 51,738,209 (GRCm39) I235T probably damaging Het
B4galnt3 T C 6: 120,201,554 (GRCm39) T164A probably damaging Het
Brip1 A G 11: 86,077,817 (GRCm39) S204P possibly damaging Het
Ccdc185 C A 1: 182,574,835 (GRCm39) S618I probably benign Het
Ckap5 T A 2: 91,406,614 (GRCm39) I805K probably damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cmtm2a A T 8: 105,019,343 (GRCm39) I82N probably damaging Het
Corin T A 5: 72,515,806 (GRCm39) H416L probably damaging Het
Csnk2a2 G A 8: 96,182,575 (GRCm39) P296L Het
Cygb T A 11: 116,540,116 (GRCm39) T178S probably benign Het
Dchs1 T C 7: 105,414,089 (GRCm39) T909A possibly damaging Het
Ddx60 C T 8: 62,436,945 (GRCm39) A965V probably benign Het
Dmbt1 A G 7: 130,700,953 (GRCm39) T1218A unknown Het
Ebf1 T C 11: 44,863,742 (GRCm39) I364T probably damaging Het
Efcab10 C A 12: 33,448,313 (GRCm39) R49S probably damaging Het
Eif2b1 G A 5: 124,717,162 (GRCm39) probably benign Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Gm49358 T A 10: 86,656,857 (GRCm39) F273Y Het
Gria2 T A 3: 80,614,550 (GRCm39) I497F possibly damaging Het
Ipo9 T C 1: 135,331,078 (GRCm39) T426A probably benign Het
Klhl11 T C 11: 100,354,811 (GRCm39) I337V probably benign Het
Krtap19-5 A T 16: 88,693,236 (GRCm39) Y25* probably null Het
Lamb2 T G 9: 108,364,722 (GRCm39) S1159A probably benign Het
Mpig6b A T 17: 35,284,328 (GRCm39) L154Q probably damaging Het
Mrpl28 T C 17: 26,343,594 (GRCm39) I118T probably damaging Het
Msh3 A T 13: 92,435,690 (GRCm39) N536K probably benign Het
Mtcl3 T C 10: 29,072,894 (GRCm39) S729P probably damaging Het
Myh8 A G 11: 67,190,598 (GRCm39) K1308E possibly damaging Het
Nav3 C A 10: 109,688,520 (GRCm39) G586W probably damaging Het
Ncoa7 T C 10: 30,570,087 (GRCm39) K291E possibly damaging Het
Nr5a1 C T 2: 38,591,993 (GRCm39) V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,469,063 (GRCm39) probably null Het
Or1o4 A T 17: 37,590,935 (GRCm39) H125Q probably benign Het
Or4f4-ps1 A T 2: 111,330,332 (GRCm39) D245V possibly damaging Het
Or4g17 T C 2: 111,210,086 (GRCm39) V247A probably damaging Het
Pcyox1l G A 18: 61,840,576 (GRCm39) P26L unknown Het
Pdzrn4 A G 15: 92,641,476 (GRCm39) S391G probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Pibf1 C T 14: 99,416,803 (GRCm39) Q459* probably null Het
Pkd1l1 C T 11: 8,897,241 (GRCm39) C556Y probably damaging Het
Plin1 A G 7: 79,379,599 (GRCm39) F84L possibly damaging Het
Rasa3 A G 8: 13,627,801 (GRCm39) probably null Het
Sdc1 G A 12: 8,840,663 (GRCm39) V143I probably benign Het
Skic3 T C 13: 76,278,446 (GRCm39) probably null Het
Skor2 C A 18: 76,947,373 (GRCm39) A365E unknown Het
Slc16a7 A G 10: 125,164,202 (GRCm39) probably null Het
Slc25a31 T A 3: 40,663,573 (GRCm39) V51E probably damaging Het
Slc6a6 C A 6: 91,703,087 (GRCm39) F153L probably damaging Het
Snx7 T A 3: 117,630,894 (GRCm39) K238M probably damaging Het
Spata3 C T 1: 85,952,075 (GRCm39) R110C unknown Het
Spata31f3 A G 4: 42,873,051 (GRCm39) L80P probably damaging Het
Sphkap T G 1: 83,241,303 (GRCm39) Q1587P probably damaging Het
Tcte1 T C 17: 45,850,618 (GRCm39) I298T possibly damaging Het
Tmem247 A G 17: 87,229,795 (GRCm39) Y120C Het
Togaram2 C G 17: 72,023,489 (GRCm39) L802V probably benign Het
Trim32 T C 4: 65,532,199 (GRCm39) V252A probably benign Het
Ube2q2l T G 6: 136,378,184 (GRCm39) R215S possibly damaging Het
Vat1 T C 11: 101,351,029 (GRCm39) K404R probably benign Het
Xirp2 C A 2: 67,342,379 (GRCm39) T1540K probably benign Het
Zc2hc1c C T 12: 85,343,386 (GRCm39) H508Y probably damaging Het
Zfp407 A T 18: 84,579,310 (GRCm39) M601K probably damaging Het
Zfp951 A T 5: 104,963,169 (GRCm39) Y132* probably null Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62,200,357 (GRCm39) missense probably damaging 0.99
IGL01363:Pard3b APN 1 62,676,799 (GRCm39) missense probably damaging 1.00
IGL01509:Pard3b APN 1 62,200,407 (GRCm39) missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62,677,021 (GRCm39) missense probably damaging 0.96
IGL01651:Pard3b APN 1 62,518,963 (GRCm39) intron probably benign
IGL01670:Pard3b APN 1 62,250,807 (GRCm39) missense probably damaging 1.00
IGL02156:Pard3b APN 1 61,807,109 (GRCm39) missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62,205,541 (GRCm39) missense probably damaging 1.00
IGL02450:Pard3b APN 1 62,571,835 (GRCm39) missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62,237,930 (GRCm39) splice site probably benign
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0060:Pard3b UTSW 1 61,678,474 (GRCm39) missense probably damaging 0.97
R0157:Pard3b UTSW 1 62,250,792 (GRCm39) missense probably damaging 0.96
R0333:Pard3b UTSW 1 62,269,371 (GRCm39) missense probably benign 0.00
R0448:Pard3b UTSW 1 62,205,628 (GRCm39) missense probably damaging 1.00
R0465:Pard3b UTSW 1 62,250,877 (GRCm39) splice site probably benign
R0497:Pard3b UTSW 1 62,479,167 (GRCm39) splice site probably null
R1264:Pard3b UTSW 1 62,203,316 (GRCm39) missense probably damaging 1.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1482:Pard3b UTSW 1 62,205,526 (GRCm39) missense probably damaging 1.00
R1554:Pard3b UTSW 1 62,677,053 (GRCm39) missense probably damaging 0.97
R1836:Pard3b UTSW 1 62,676,763 (GRCm39) missense probably benign 0.03
R2005:Pard3b UTSW 1 62,184,050 (GRCm39) missense probably benign 0.12
R2220:Pard3b UTSW 1 62,518,842 (GRCm39) nonsense probably null
R2435:Pard3b UTSW 1 62,626,897 (GRCm39) missense probably damaging 1.00
R3015:Pard3b UTSW 1 62,384,037 (GRCm39) missense probably damaging 1.00
R3688:Pard3b UTSW 1 62,518,728 (GRCm39) missense probably benign
R3712:Pard3b UTSW 1 62,383,137 (GRCm39) missense probably damaging 1.00
R3799:Pard3b UTSW 1 62,200,388 (GRCm39) missense probably benign 0.06
R3942:Pard3b UTSW 1 62,198,611 (GRCm39) missense probably damaging 1.00
R4683:Pard3b UTSW 1 62,255,675 (GRCm39) missense probably benign
R4729:Pard3b UTSW 1 62,250,843 (GRCm39) missense probably damaging 1.00
R4898:Pard3b UTSW 1 61,807,159 (GRCm39) missense probably damaging 1.00
R4981:Pard3b UTSW 1 62,383,219 (GRCm39) missense probably damaging 1.00
R5049:Pard3b UTSW 1 62,200,320 (GRCm39) missense probably benign 0.01
R5223:Pard3b UTSW 1 62,383,272 (GRCm39) missense probably damaging 1.00
R5476:Pard3b UTSW 1 62,049,565 (GRCm39) missense probably benign 0.10
R5541:Pard3b UTSW 1 61,678,502 (GRCm39) missense probably damaging 1.00
R5672:Pard3b UTSW 1 62,049,625 (GRCm39) missense probably benign 0.11
R5714:Pard3b UTSW 1 62,677,075 (GRCm39) missense probably null 0.99
R5722:Pard3b UTSW 1 62,479,160 (GRCm39) splice site probably null
R5793:Pard3b UTSW 1 61,807,132 (GRCm39) missense probably damaging 1.00
R5930:Pard3b UTSW 1 61,807,289 (GRCm39) intron probably benign
R5950:Pard3b UTSW 1 62,255,690 (GRCm39) missense probably benign 0.04
R5997:Pard3b UTSW 1 62,115,568 (GRCm39) missense probably damaging 1.00
R6646:Pard3b UTSW 1 62,200,280 (GRCm39) missense probably benign 0.32
R6720:Pard3b UTSW 1 62,198,629 (GRCm39) missense probably damaging 0.99
R6809:Pard3b UTSW 1 62,200,340 (GRCm39) missense probably damaging 1.00
R7148:Pard3b UTSW 1 62,479,191 (GRCm39) missense probably benign 0.01
R7847:Pard3b UTSW 1 62,383,093 (GRCm39) missense probably benign 0.00
R7879:Pard3b UTSW 1 62,198,670 (GRCm39) missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62,193,148 (GRCm39) missense probably damaging 1.00
R8329:Pard3b UTSW 1 62,676,957 (GRCm39) missense probably benign 0.30
R8766:Pard3b UTSW 1 62,198,637 (GRCm39) missense probably benign 0.35
R8833:Pard3b UTSW 1 62,384,158 (GRCm39) missense probably benign 0.00
R8889:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8892:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8907:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R8909:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R9215:Pard3b UTSW 1 62,203,344 (GRCm39) missense probably damaging 1.00
R9310:Pard3b UTSW 1 62,205,528 (GRCm39) missense probably damaging 0.99
R9542:Pard3b UTSW 1 62,250,786 (GRCm39) nonsense probably null
Z1176:Pard3b UTSW 1 62,278,051 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGCAGTTATTTATACATAAGACCTT -3'
(R):5'- CCAGGTGAAACCAAAACAGATG -3'

Sequencing Primer
(F):5'- GACTTCCATCAGTGACTAATTGTGGC -3'
(R):5'- GCTGCTTGGTATAGGAAAA -3'
Posted On 2020-06-30