Incidental Mutation 'R8125:Fam205c'
ID631692
Institutional Source Beutler Lab
Gene Symbol Fam205c
Ensembl Gene ENSMUSG00000050141
Gene Namefamily with sequence similarity 205, member C
SynonymsBC049635
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8125 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location42868004-42874234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42873051 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 80 (L80P)
Ref Sequence ENSEMBL: ENSMUSP00000103612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055944] [ENSMUST00000107978]
Predicted Effect probably damaging
Transcript: ENSMUST00000055944
AA Change: L80P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060318
Gene: ENSMUSG00000050141
AA Change: L80P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 51 139 2.7e-31 PFAM
internal_repeat_1 147 168 5.83e-10 PROSPERO
internal_repeat_1 180 201 5.83e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107978
AA Change: L80P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103612
Gene: ENSMUSG00000050141
AA Change: L80P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 52 138 3.4e-28 PFAM
internal_repeat_1 147 168 5.79e-10 PROSPERO
internal_repeat_1 180 201 5.79e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,475,652 T143K probably benign Het
4933434E20Rik T A 3: 90,065,511 V74D possibly damaging Het
Acot11 C T 4: 106,760,080 probably null Het
Adam20 A T 8: 40,794,936 I28L probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak C T 19: 9,011,876 A3508V possibly damaging Het
Arhgap20 T C 9: 51,826,909 I235T probably damaging Het
B4galnt3 T C 6: 120,224,593 T164A probably damaging Het
Brip1 A G 11: 86,186,991 S204P possibly damaging Het
Ccdc185 C A 1: 182,747,270 S618I probably benign Het
Ckap5 T A 2: 91,576,269 I805K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cmtm2a A T 8: 104,292,711 I82N probably damaging Het
Corin T A 5: 72,358,463 H416L probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Dchs1 T C 7: 105,764,882 T909A possibly damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dmbt1 A G 7: 131,099,223 T1218A unknown Het
E330021D16Rik T G 6: 136,401,186 R215S possibly damaging Het
Ebf1 T C 11: 44,972,915 I364T probably damaging Het
Efcab10 C A 12: 33,398,314 R49S probably damaging Het
Eif2b1 G A 5: 124,579,099 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm49358 T A 10: 86,820,993 F273Y Het
Gria2 T A 3: 80,707,243 I497F possibly damaging Het
Ipo9 T C 1: 135,403,340 T426A probably benign Het
Klhl11 T C 11: 100,463,985 I337V probably benign Het
Krtap19-5 A T 16: 88,896,348 Y25* probably null Het
Lamb2 T G 9: 108,487,523 S1159A probably benign Het
Mpig6b A T 17: 35,065,352 L154Q probably damaging Het
Mrpl28 T C 17: 26,124,620 I118T probably damaging Het
Msh3 A T 13: 92,299,182 N536K probably benign Het
Myh8 A G 11: 67,299,772 K1308E possibly damaging Het
Nav3 C A 10: 109,852,659 G586W probably damaging Het
Ncoa7 T C 10: 30,694,091 K291E possibly damaging Het
Nr5a1 C T 2: 38,701,981 V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,578,237 probably null Het
Olfr1284 T C 2: 111,379,741 V247A probably damaging Het
Olfr1291-ps1 A T 2: 111,499,987 D245V possibly damaging Het
Olfr99 A T 17: 37,280,044 H125Q probably benign Het
Pard3b T C 1: 61,767,984 Y53H probably damaging Het
Pcyox1l G A 18: 61,707,505 P26L unknown Het
Pdzrn4 A G 15: 92,743,595 S391G probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Pibf1 C T 14: 99,179,367 Q459* probably null Het
Pkd1l1 C T 11: 8,947,241 C556Y probably damaging Het
Plin1 A G 7: 79,729,851 F84L possibly damaging Het
Sdc1 G A 12: 8,790,663 V143I probably benign Het
Skor2 C A 18: 76,859,678 A365E unknown Het
Slc25a31 T A 3: 40,709,143 V51E probably damaging Het
Slc6a6 C A 6: 91,726,106 F153L probably damaging Het
Snx7 T A 3: 117,837,245 K238M probably damaging Het
Soga3 T C 10: 29,196,898 S729P probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Sphkap T G 1: 83,263,582 Q1587P probably damaging Het
Tcte1 T C 17: 45,539,692 I298T possibly damaging Het
Tmem247 A G 17: 86,922,367 Y120C Het
Togaram2 C G 17: 71,716,494 L802V probably benign Het
Trim32 T C 4: 65,613,962 V252A probably benign Het
Ttc37 T C 13: 76,130,327 probably null Het
Vat1 T C 11: 101,460,203 K404R probably benign Het
Xirp2 C A 2: 67,512,035 T1540K probably benign Het
Zc2hc1c C T 12: 85,296,612 H508Y probably damaging Het
Zfp407 A T 18: 84,561,185 M601K probably damaging Het
Zfp951 A T 5: 104,815,303 Y132* probably null Het
Other mutations in Fam205c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Fam205c APN 4 42868564 missense probably benign 0.40
IGL01697:Fam205c APN 4 42874163 missense probably benign
IGL02413:Fam205c APN 4 42868549 missense probably damaging 0.99
IGL02450:Fam205c APN 4 42874127 missense probably benign
R0433:Fam205c UTSW 4 42874013 splice site probably benign
R1580:Fam205c UTSW 4 42874020 splice site probably null
R2042:Fam205c UTSW 4 42874030 missense possibly damaging 0.96
R2102:Fam205c UTSW 4 42868558 missense probably benign 0.00
R3824:Fam205c UTSW 4 42873492 critical splice donor site probably null
R4192:Fam205c UTSW 4 42874185 utr 5 prime probably benign
R4668:Fam205c UTSW 4 42871608 missense probably benign 0.00
R4690:Fam205c UTSW 4 42873032 splice site probably null
R5743:Fam205c UTSW 4 42873087 missense probably damaging 0.99
R5868:Fam205c UTSW 4 42871711 missense probably damaging 0.96
R6186:Fam205c UTSW 4 42872000 missense possibly damaging 0.95
R6778:Fam205c UTSW 4 42868522 missense possibly damaging 0.94
R6986:Fam205c UTSW 4 42868696 missense possibly damaging 0.90
R7318:Fam205c UTSW 4 42871823 small deletion probably benign
R7413:Fam205c UTSW 4 42871823 small deletion probably benign
R7675:Fam205c UTSW 4 42871823 small deletion probably benign
R7785:Fam205c UTSW 4 42871823 small deletion probably benign
R7842:Fam205c UTSW 4 42871823 small deletion probably benign
RF040:Fam205c UTSW 4 42871823 small deletion probably benign
X0052:Fam205c UTSW 4 42874047 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGAATTGCAGACCTACAGGG -3'
(R):5'- AGTTGTACTCTGAGCATGCG -3'

Sequencing Primer
(F):5'- GTAAAATGGATGCCACTTCCCTG -3'
(R):5'- GCTCTGGGGGTTGCCAAG -3'
Posted On2020-06-30