Incidental Mutation 'R8125:Corin'
ID631695
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R8125 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72358463 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 416 (H416L)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably damaging
Transcript: ENSMUST00000005352
AA Change: H416L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: H416L

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167460
AA Change: H350L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: H350L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175766
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176974
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177290
AA Change: H283L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: H283L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,475,652 T143K probably benign Het
4933434E20Rik T A 3: 90,065,511 V74D possibly damaging Het
Acot11 C T 4: 106,760,080 probably null Het
Adam20 A T 8: 40,794,936 I28L probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak C T 19: 9,011,876 A3508V possibly damaging Het
Arhgap20 T C 9: 51,826,909 I235T probably damaging Het
B4galnt3 T C 6: 120,224,593 T164A probably damaging Het
Brip1 A G 11: 86,186,991 S204P possibly damaging Het
Ccdc185 C A 1: 182,747,270 S618I probably benign Het
Ckap5 T A 2: 91,576,269 I805K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cmtm2a A T 8: 104,292,711 I82N probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Dchs1 T C 7: 105,764,882 T909A possibly damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dmbt1 A G 7: 131,099,223 T1218A unknown Het
E330021D16Rik T G 6: 136,401,186 R215S possibly damaging Het
Ebf1 T C 11: 44,972,915 I364T probably damaging Het
Efcab10 C A 12: 33,398,314 R49S probably damaging Het
Eif2b1 G A 5: 124,579,099 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam205c A G 4: 42,873,051 L80P probably damaging Het
Gm49358 T A 10: 86,820,993 F273Y Het
Gria2 T A 3: 80,707,243 I497F possibly damaging Het
Ipo9 T C 1: 135,403,340 T426A probably benign Het
Klhl11 T C 11: 100,463,985 I337V probably benign Het
Krtap19-5 A T 16: 88,896,348 Y25* probably null Het
Lamb2 T G 9: 108,487,523 S1159A probably benign Het
Mpig6b A T 17: 35,065,352 L154Q probably damaging Het
Mrpl28 T C 17: 26,124,620 I118T probably damaging Het
Msh3 A T 13: 92,299,182 N536K probably benign Het
Myh8 A G 11: 67,299,772 K1308E possibly damaging Het
Nav3 C A 10: 109,852,659 G586W probably damaging Het
Ncoa7 T C 10: 30,694,091 K291E possibly damaging Het
Nr5a1 C T 2: 38,701,981 V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,578,237 probably null Het
Olfr1284 T C 2: 111,379,741 V247A probably damaging Het
Olfr1291-ps1 A T 2: 111,499,987 D245V possibly damaging Het
Olfr99 A T 17: 37,280,044 H125Q probably benign Het
Pard3b T C 1: 61,767,984 Y53H probably damaging Het
Pcyox1l G A 18: 61,707,505 P26L unknown Het
Pdzrn4 A G 15: 92,743,595 S391G probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Pibf1 C T 14: 99,179,367 Q459* probably null Het
Pkd1l1 C T 11: 8,947,241 C556Y probably damaging Het
Plin1 A G 7: 79,729,851 F84L possibly damaging Het
Sdc1 G A 12: 8,790,663 V143I probably benign Het
Skor2 C A 18: 76,859,678 A365E unknown Het
Slc25a31 T A 3: 40,709,143 V51E probably damaging Het
Slc6a6 C A 6: 91,726,106 F153L probably damaging Het
Snx7 T A 3: 117,837,245 K238M probably damaging Het
Soga3 T C 10: 29,196,898 S729P probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Sphkap T G 1: 83,263,582 Q1587P probably damaging Het
Tcte1 T C 17: 45,539,692 I298T possibly damaging Het
Tmem247 A G 17: 86,922,367 Y120C Het
Togaram2 C G 17: 71,716,494 L802V probably benign Het
Trim32 T C 4: 65,613,962 V252A probably benign Het
Ttc37 T C 13: 76,130,327 probably null Het
Vat1 T C 11: 101,460,203 K404R probably benign Het
Xirp2 C A 2: 67,512,035 T1540K probably benign Het
Zc2hc1c C T 12: 85,296,612 H508Y probably damaging Het
Zfp407 A T 18: 84,561,185 M601K probably damaging Het
Zfp951 A T 5: 104,815,303 Y132* probably null Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
R7242:Corin UTSW 5 72305055 missense probably benign 0.14
R7452:Corin UTSW 5 72435247 missense possibly damaging 0.94
R7783:Corin UTSW 5 72301624 missense probably benign 0.26
R7903:Corin UTSW 5 72301500 missense probably benign 0.00
R8007:Corin UTSW 5 72316103 missense probably damaging 0.96
R8215:Corin UTSW 5 72305018 missense probably damaging 1.00
R8251:Corin UTSW 5 72356926 missense probably damaging 1.00
Z1177:Corin UTSW 5 72454493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGAGCCATCCTCCCTGAGTG -3'
(R):5'- AGATGAGTCTTTGCCTTCAGGG -3'

Sequencing Primer
(F):5'- CCCTGAGTGCTGTTTACATAATGGAC -3'
(R):5'- CTGACACTGGTAGAAAGTAGCATTTG -3'
Posted On2020-06-30