Incidental Mutation 'R8125:Slc6a6'
ID 631698
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 067554-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8125 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 91703087 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 153 (F153L)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185] [ENSMUST00000205480] [ENSMUST00000205828] [ENSMUST00000206545]
AlphaFold O35316
Predicted Effect probably damaging
Transcript: ENSMUST00000032185
AA Change: F153L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: F153L

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205480
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000205828
Predicted Effect probably benign
Transcript: ENSMUST00000206545
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,608,709 (GRCm39) T143K probably benign Het
4933434E20Rik T A 3: 89,972,818 (GRCm39) V74D possibly damaging Het
Acot11 C T 4: 106,617,277 (GRCm39) probably null Het
Adam20 A T 8: 41,247,973 (GRCm39) I28L probably benign Het
Adamtsl3 A G 7: 82,099,541 (GRCm39) probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak C T 19: 8,989,240 (GRCm39) A3508V possibly damaging Het
Arhgap20 T C 9: 51,738,209 (GRCm39) I235T probably damaging Het
B4galnt3 T C 6: 120,201,554 (GRCm39) T164A probably damaging Het
Brip1 A G 11: 86,077,817 (GRCm39) S204P possibly damaging Het
Ccdc185 C A 1: 182,574,835 (GRCm39) S618I probably benign Het
Ckap5 T A 2: 91,406,614 (GRCm39) I805K probably damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cmtm2a A T 8: 105,019,343 (GRCm39) I82N probably damaging Het
Corin T A 5: 72,515,806 (GRCm39) H416L probably damaging Het
Csnk2a2 G A 8: 96,182,575 (GRCm39) P296L Het
Cygb T A 11: 116,540,116 (GRCm39) T178S probably benign Het
Dchs1 T C 7: 105,414,089 (GRCm39) T909A possibly damaging Het
Ddx60 C T 8: 62,436,945 (GRCm39) A965V probably benign Het
Dmbt1 A G 7: 130,700,953 (GRCm39) T1218A unknown Het
Ebf1 T C 11: 44,863,742 (GRCm39) I364T probably damaging Het
Efcab10 C A 12: 33,448,313 (GRCm39) R49S probably damaging Het
Eif2b1 G A 5: 124,717,162 (GRCm39) probably benign Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Gm49358 T A 10: 86,656,857 (GRCm39) F273Y Het
Gria2 T A 3: 80,614,550 (GRCm39) I497F possibly damaging Het
Ipo9 T C 1: 135,331,078 (GRCm39) T426A probably benign Het
Klhl11 T C 11: 100,354,811 (GRCm39) I337V probably benign Het
Krtap19-5 A T 16: 88,693,236 (GRCm39) Y25* probably null Het
Lamb2 T G 9: 108,364,722 (GRCm39) S1159A probably benign Het
Mpig6b A T 17: 35,284,328 (GRCm39) L154Q probably damaging Het
Mrpl28 T C 17: 26,343,594 (GRCm39) I118T probably damaging Het
Msh3 A T 13: 92,435,690 (GRCm39) N536K probably benign Het
Mtcl3 T C 10: 29,072,894 (GRCm39) S729P probably damaging Het
Myh8 A G 11: 67,190,598 (GRCm39) K1308E possibly damaging Het
Nav3 C A 10: 109,688,520 (GRCm39) G586W probably damaging Het
Ncoa7 T C 10: 30,570,087 (GRCm39) K291E possibly damaging Het
Nr5a1 C T 2: 38,591,993 (GRCm39) V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,469,063 (GRCm39) probably null Het
Or1o4 A T 17: 37,590,935 (GRCm39) H125Q probably benign Het
Or4f4-ps1 A T 2: 111,330,332 (GRCm39) D245V possibly damaging Het
Or4g17 T C 2: 111,210,086 (GRCm39) V247A probably damaging Het
Pard3b T C 1: 61,807,143 (GRCm39) Y53H probably damaging Het
Pcyox1l G A 18: 61,840,576 (GRCm39) P26L unknown Het
Pdzrn4 A G 15: 92,641,476 (GRCm39) S391G probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Pibf1 C T 14: 99,416,803 (GRCm39) Q459* probably null Het
Pkd1l1 C T 11: 8,897,241 (GRCm39) C556Y probably damaging Het
Plin1 A G 7: 79,379,599 (GRCm39) F84L possibly damaging Het
Rasa3 A G 8: 13,627,801 (GRCm39) probably null Het
Sdc1 G A 12: 8,840,663 (GRCm39) V143I probably benign Het
Skic3 T C 13: 76,278,446 (GRCm39) probably null Het
Skor2 C A 18: 76,947,373 (GRCm39) A365E unknown Het
Slc16a7 A G 10: 125,164,202 (GRCm39) probably null Het
Slc25a31 T A 3: 40,663,573 (GRCm39) V51E probably damaging Het
Snx7 T A 3: 117,630,894 (GRCm39) K238M probably damaging Het
Spata3 C T 1: 85,952,075 (GRCm39) R110C unknown Het
Spata31f3 A G 4: 42,873,051 (GRCm39) L80P probably damaging Het
Sphkap T G 1: 83,241,303 (GRCm39) Q1587P probably damaging Het
Tcte1 T C 17: 45,850,618 (GRCm39) I298T possibly damaging Het
Tmem247 A G 17: 87,229,795 (GRCm39) Y120C Het
Togaram2 C G 17: 72,023,489 (GRCm39) L802V probably benign Het
Trim32 T C 4: 65,532,199 (GRCm39) V252A probably benign Het
Ube2q2l T G 6: 136,378,184 (GRCm39) R215S possibly damaging Het
Vat1 T C 11: 101,351,029 (GRCm39) K404R probably benign Het
Xirp2 C A 2: 67,342,379 (GRCm39) T1540K probably benign Het
Zc2hc1c C T 12: 85,343,386 (GRCm39) H508Y probably damaging Het
Zfp407 A T 18: 84,579,310 (GRCm39) M601K probably damaging Het
Zfp951 A T 5: 104,963,169 (GRCm39) Y132* probably null Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1327:Slc6a6 UTSW 6 91,703,016 (GRCm39) missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91,731,929 (GRCm39) missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91,716,946 (GRCm39) missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8363:Slc6a6 UTSW 6 91,727,277 (GRCm39) missense probably benign 0.03
R8836:Slc6a6 UTSW 6 91,725,444 (GRCm39) missense probably damaging 0.96
R9102:Slc6a6 UTSW 6 91,731,940 (GRCm39) missense probably benign 0.10
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTGAGATGGCCCCTTTG -3'
(R):5'- GGAAGATACTGTCCCCTCTTG -3'

Sequencing Primer
(F):5'- CCTTTGTCCCACAGACTGG -3'
(R):5'- GAAGATACTGTCCCCTCTTGACCTG -3'
Posted On 2020-06-30