Incidental Mutation 'R0707:Olfr467'
ID63170
Institutional Source Beutler Lab
Gene Symbol Olfr467
Ensembl Gene ENSMUSG00000066242
Gene Nameolfactory receptor 467
SynonymsMOR204-33P, GA_x6K02T2PBJ9-10144091-10145011
MMRRC Submission 038890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0707 (G1)
Quality Score102
Status Validated
Chromosome7
Chromosomal Location107812263-107816336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107815124 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 182 (D182G)
Ref Sequence ENSEMBL: ENSMUSP00000081811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084756] [ENSMUST00000208563] [ENSMUST00000214253]
Predicted Effect probably damaging
Transcript: ENSMUST00000084756
AA Change: D182G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081811
Gene: ENSMUSG00000066242
AA Change: D182G

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 5.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 37 307 8.3e-7 PFAM
Pfam:7tm_1 43 292 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207203
Predicted Effect probably damaging
Transcript: ENSMUST00000208563
AA Change: D180G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214253
AA Change: D180G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,258,321 N2881K unknown Het
Acot11 A G 4: 106,760,132 F259S probably damaging Het
Aldh16a1 T A 7: 45,144,507 probably benign Het
Ankrd24 A T 10: 81,642,713 probably benign Het
Arhgap5 T C 12: 52,518,168 S641P probably damaging Het
Arpp21 A C 9: 112,157,756 S242R probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Ccdc65 G A 15: 98,709,214 V101I possibly damaging Het
Ccr7 T A 11: 99,145,983 T38S probably damaging Het
Cdc14a T C 3: 116,293,713 probably benign Het
Ces2f C T 8: 104,950,986 H208Y possibly damaging Het
Chst1 C A 2: 92,613,619 N145K possibly damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cog6 C T 3: 53,013,862 V108I possibly damaging Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Dicer1 A T 12: 104,706,885 F792I probably damaging Het
Dnajc13 T C 9: 104,172,582 K1780R probably benign Het
Dph5 A C 3: 115,915,133 N155H probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Etl4 C A 2: 20,805,571 probably benign Het
Flt3l T C 7: 45,136,026 S9G probably benign Het
Fmnl2 A G 2: 53,054,486 E159G possibly damaging Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Herc6 G A 6: 57,662,362 G905E possibly damaging Het
Hhip T A 8: 79,998,255 N296I probably damaging Het
Hmgcr A T 13: 96,650,643 probably benign Het
Kalrn T G 16: 34,010,581 N723H possibly damaging Het
Mroh5 T A 15: 73,790,739 Y242F possibly damaging Het
Msh3 T A 13: 92,347,340 K258* probably null Het
Myo1a T C 10: 127,719,863 probably benign Het
Nlrp4f C T 13: 65,194,503 E443K probably benign Het
Nupr1l A G 5: 129,908,692 Y34C probably damaging Het
Ociad1 T C 5: 73,294,912 probably benign Het
Olfr1469 A T 19: 13,411,420 M284L probably benign Het
Olfr313 T A 11: 58,817,751 L248M probably damaging Het
Olfr366 A T 2: 37,220,196 K236* probably null Het
Olfr522 T C 7: 140,162,089 N287S probably damaging Het
P2ry12 C A 3: 59,217,487 V256F probably damaging Het
Pcdhb22 T A 18: 37,518,851 I124N probably damaging Het
Pcnt A G 10: 76,420,541 F622L probably damaging Het
Pfas A T 11: 68,998,037 N361K probably benign Het
Plod2 T G 9: 92,605,427 L600V possibly damaging Het
Pole T C 5: 110,298,988 Y631H probably damaging Het
Proser1 T C 3: 53,478,776 L693P probably damaging Het
Ptprd A G 4: 75,957,239 Y1195H probably damaging Het
Rbm27 T A 18: 42,326,026 probably null Het
Ric8a A G 7: 140,857,973 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scfd1 A T 12: 51,412,577 K307M probably damaging Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Smg7 T G 1: 152,870,757 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Syne3 A G 12: 104,969,360 L53P probably damaging Het
Tcea1 T A 1: 4,880,346 probably benign Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Trim25 A T 11: 88,999,738 T84S probably benign Het
Trip4 A T 9: 65,839,004 F537I possibly damaging Het
Uaca G A 9: 60,848,618 probably benign Het
Ugt2b34 T A 5: 86,892,899 Y388F possibly damaging Het
Vmn2r71 T C 7: 85,619,432 V281A probably benign Het
Vps13d A T 4: 145,155,932 D1030E probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Zfp296 A G 7: 19,579,736 D172G probably benign Het
Zfp977 C A 7: 42,580,534 C189F probably damaging Het
Other mutations in Olfr467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0450:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0918:Olfr467 UTSW 7 107815211 missense probably benign 0.03
R1416:Olfr467 UTSW 7 107815262 missense probably damaging 1.00
R1988:Olfr467 UTSW 7 107814700 missense probably benign
R1989:Olfr467 UTSW 7 107814700 missense probably benign
R2219:Olfr467 UTSW 7 107815222 missense probably benign
R2241:Olfr467 UTSW 7 107814833 missense possibly damaging 0.62
R2866:Olfr467 UTSW 7 107814919 missense probably benign 0.06
R4946:Olfr467 UTSW 7 107815382 missense possibly damaging 0.90
R4972:Olfr467 UTSW 7 107814746 missense probably benign 0.10
R5099:Olfr467 UTSW 7 107814602 missense probably benign 0.00
R5310:Olfr467 UTSW 7 107814964 missense probably damaging 1.00
R5323:Olfr467 UTSW 7 107814676 missense possibly damaging 0.96
R5531:Olfr467 UTSW 7 107815244 missense probably benign 0.03
R5672:Olfr467 UTSW 7 107814637 missense probably damaging 1.00
R5758:Olfr467 UTSW 7 107814815 missense probably damaging 0.99
R5891:Olfr467 UTSW 7 107815180 missense probably damaging 1.00
R6016:Olfr467 UTSW 7 107815012 missense probably benign 0.01
R6399:Olfr467 UTSW 7 107814754 missense possibly damaging 0.78
R6466:Olfr467 UTSW 7 107814694 missense probably benign
R6894:Olfr467 UTSW 7 107815064 missense probably benign 0.25
R7543:Olfr467 UTSW 7 107815101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAGTCCAGCTTGGCTCTGATG -3'
(R):5'- CAAGGGATTCAGCATGGGGATCAC -3'

Sequencing Primer
(F):5'- ACTGCTGAGTGCTTCCTG -3'
(R):5'- TGTCCCATAAAACAAGGTGACTG -3'
Posted On2013-07-30