Incidental Mutation 'R8125:Ddx60'
ID631705
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R8125 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61983911 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 965 (A965V)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: A964V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: A964V

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: A965V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: A965V

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,475,652 T143K probably benign Het
4933434E20Rik T A 3: 90,065,511 V74D possibly damaging Het
Acot11 C T 4: 106,760,080 probably null Het
Adam20 A T 8: 40,794,936 I28L probably benign Het
Adamtsl3 A G 7: 82,450,333 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak C T 19: 9,011,876 A3508V possibly damaging Het
Arhgap20 T C 9: 51,826,909 I235T probably damaging Het
B4galnt3 T C 6: 120,224,593 T164A probably damaging Het
Brip1 A G 11: 86,186,991 S204P possibly damaging Het
Ccdc185 C A 1: 182,747,270 S618I probably benign Het
Ckap5 T A 2: 91,576,269 I805K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cmtm2a A T 8: 104,292,711 I82N probably damaging Het
Corin T A 5: 72,358,463 H416L probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Dchs1 T C 7: 105,764,882 T909A possibly damaging Het
Dmbt1 A G 7: 131,099,223 T1218A unknown Het
E330021D16Rik T G 6: 136,401,186 R215S possibly damaging Het
Ebf1 T C 11: 44,972,915 I364T probably damaging Het
Efcab10 C A 12: 33,398,314 R49S probably damaging Het
Eif2b1 G A 5: 124,579,099 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam205c A G 4: 42,873,051 L80P probably damaging Het
Gm49358 T A 10: 86,820,993 F273Y Het
Gria2 T A 3: 80,707,243 I497F possibly damaging Het
Ipo9 T C 1: 135,403,340 T426A probably benign Het
Klhl11 T C 11: 100,463,985 I337V probably benign Het
Krtap19-5 A T 16: 88,896,348 Y25* probably null Het
Lamb2 T G 9: 108,487,523 S1159A probably benign Het
Mpig6b A T 17: 35,065,352 L154Q probably damaging Het
Mrpl28 T C 17: 26,124,620 I118T probably damaging Het
Msh3 A T 13: 92,299,182 N536K probably benign Het
Myh8 A G 11: 67,299,772 K1308E possibly damaging Het
Nav3 C A 10: 109,852,659 G586W probably damaging Het
Ncoa7 T C 10: 30,694,091 K291E possibly damaging Het
Nr5a1 C T 2: 38,701,981 V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,578,237 probably null Het
Olfr1284 T C 2: 111,379,741 V247A probably damaging Het
Olfr1291-ps1 A T 2: 111,499,987 D245V possibly damaging Het
Olfr99 A T 17: 37,280,044 H125Q probably benign Het
Pard3b T C 1: 61,767,984 Y53H probably damaging Het
Pcyox1l G A 18: 61,707,505 P26L unknown Het
Pdzrn4 A G 15: 92,743,595 S391G probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Pibf1 C T 14: 99,179,367 Q459* probably null Het
Pkd1l1 C T 11: 8,947,241 C556Y probably damaging Het
Plin1 A G 7: 79,729,851 F84L possibly damaging Het
Rasa3 A G 8: 13,577,801 probably null Het
Sdc1 G A 12: 8,790,663 V143I probably benign Het
Skor2 C A 18: 76,859,678 A365E unknown Het
Slc16a7 A G 10: 125,328,333 probably null Het
Slc25a31 T A 3: 40,709,143 V51E probably damaging Het
Slc6a6 C A 6: 91,726,106 F153L probably damaging Het
Snx7 T A 3: 117,837,245 K238M probably damaging Het
Soga3 T C 10: 29,196,898 S729P probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Sphkap T G 1: 83,263,582 Q1587P probably damaging Het
Tcte1 T C 17: 45,539,692 I298T possibly damaging Het
Tmem247 A G 17: 86,922,367 Y120C Het
Togaram2 C G 17: 71,716,494 L802V probably benign Het
Trim32 T C 4: 65,613,962 V252A probably benign Het
Ttc37 T C 13: 76,130,327 probably null Het
Vat1 T C 11: 101,460,203 K404R probably benign Het
Xirp2 C A 2: 67,512,035 T1540K probably benign Het
Zc2hc1c C T 12: 85,296,612 H508Y probably damaging Het
Zfp407 A T 18: 84,561,185 M601K probably damaging Het
Zfp951 A T 5: 104,815,303 Y132* probably null Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTAGTGGCTGATCTATGCTATGC -3'
(R):5'- TCTCCATAGAGCACTGGAGG -3'

Sequencing Primer
(F):5'- ATGGCTCCATGGAGTTCAAC -3'
(R):5'- GGGGGAAGGTGAGATTTTCCAAATG -3'
Posted On2020-06-30