Incidental Mutation 'R8125:Ddx60'
ID 631705
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DExD/H box helicase 60
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
MMRRC Submission 067554-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R8125 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 62381121-62490735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 62436945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 965 (A965V)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: A964V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: A964V

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: A965V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: A965V

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,608,709 (GRCm39) T143K probably benign Het
4933434E20Rik T A 3: 89,972,818 (GRCm39) V74D possibly damaging Het
Acot11 C T 4: 106,617,277 (GRCm39) probably null Het
Adam20 A T 8: 41,247,973 (GRCm39) I28L probably benign Het
Adamtsl3 A G 7: 82,099,541 (GRCm39) probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak C T 19: 8,989,240 (GRCm39) A3508V possibly damaging Het
Arhgap20 T C 9: 51,738,209 (GRCm39) I235T probably damaging Het
B4galnt3 T C 6: 120,201,554 (GRCm39) T164A probably damaging Het
Brip1 A G 11: 86,077,817 (GRCm39) S204P possibly damaging Het
Ccdc185 C A 1: 182,574,835 (GRCm39) S618I probably benign Het
Ckap5 T A 2: 91,406,614 (GRCm39) I805K probably damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cmtm2a A T 8: 105,019,343 (GRCm39) I82N probably damaging Het
Corin T A 5: 72,515,806 (GRCm39) H416L probably damaging Het
Csnk2a2 G A 8: 96,182,575 (GRCm39) P296L Het
Cygb T A 11: 116,540,116 (GRCm39) T178S probably benign Het
Dchs1 T C 7: 105,414,089 (GRCm39) T909A possibly damaging Het
Dmbt1 A G 7: 130,700,953 (GRCm39) T1218A unknown Het
Ebf1 T C 11: 44,863,742 (GRCm39) I364T probably damaging Het
Efcab10 C A 12: 33,448,313 (GRCm39) R49S probably damaging Het
Eif2b1 G A 5: 124,717,162 (GRCm39) probably benign Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Gm49358 T A 10: 86,656,857 (GRCm39) F273Y Het
Gria2 T A 3: 80,614,550 (GRCm39) I497F possibly damaging Het
Ipo9 T C 1: 135,331,078 (GRCm39) T426A probably benign Het
Klhl11 T C 11: 100,354,811 (GRCm39) I337V probably benign Het
Krtap19-5 A T 16: 88,693,236 (GRCm39) Y25* probably null Het
Lamb2 T G 9: 108,364,722 (GRCm39) S1159A probably benign Het
Mpig6b A T 17: 35,284,328 (GRCm39) L154Q probably damaging Het
Mrpl28 T C 17: 26,343,594 (GRCm39) I118T probably damaging Het
Msh3 A T 13: 92,435,690 (GRCm39) N536K probably benign Het
Mtcl3 T C 10: 29,072,894 (GRCm39) S729P probably damaging Het
Myh8 A G 11: 67,190,598 (GRCm39) K1308E possibly damaging Het
Nav3 C A 10: 109,688,520 (GRCm39) G586W probably damaging Het
Ncoa7 T C 10: 30,570,087 (GRCm39) K291E possibly damaging Het
Nr5a1 C T 2: 38,591,993 (GRCm39) V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,469,063 (GRCm39) probably null Het
Or1o4 A T 17: 37,590,935 (GRCm39) H125Q probably benign Het
Or4f4-ps1 A T 2: 111,330,332 (GRCm39) D245V possibly damaging Het
Or4g17 T C 2: 111,210,086 (GRCm39) V247A probably damaging Het
Pard3b T C 1: 61,807,143 (GRCm39) Y53H probably damaging Het
Pcyox1l G A 18: 61,840,576 (GRCm39) P26L unknown Het
Pdzrn4 A G 15: 92,641,476 (GRCm39) S391G probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Pibf1 C T 14: 99,416,803 (GRCm39) Q459* probably null Het
Pkd1l1 C T 11: 8,897,241 (GRCm39) C556Y probably damaging Het
Plin1 A G 7: 79,379,599 (GRCm39) F84L possibly damaging Het
Rasa3 A G 8: 13,627,801 (GRCm39) probably null Het
Sdc1 G A 12: 8,840,663 (GRCm39) V143I probably benign Het
Skic3 T C 13: 76,278,446 (GRCm39) probably null Het
Skor2 C A 18: 76,947,373 (GRCm39) A365E unknown Het
Slc16a7 A G 10: 125,164,202 (GRCm39) probably null Het
Slc25a31 T A 3: 40,663,573 (GRCm39) V51E probably damaging Het
Slc6a6 C A 6: 91,703,087 (GRCm39) F153L probably damaging Het
Snx7 T A 3: 117,630,894 (GRCm39) K238M probably damaging Het
Spata3 C T 1: 85,952,075 (GRCm39) R110C unknown Het
Spata31f3 A G 4: 42,873,051 (GRCm39) L80P probably damaging Het
Sphkap T G 1: 83,241,303 (GRCm39) Q1587P probably damaging Het
Tcte1 T C 17: 45,850,618 (GRCm39) I298T possibly damaging Het
Tmem247 A G 17: 87,229,795 (GRCm39) Y120C Het
Togaram2 C G 17: 72,023,489 (GRCm39) L802V probably benign Het
Trim32 T C 4: 65,532,199 (GRCm39) V252A probably benign Het
Ube2q2l T G 6: 136,378,184 (GRCm39) R215S possibly damaging Het
Vat1 T C 11: 101,351,029 (GRCm39) K404R probably benign Het
Xirp2 C A 2: 67,342,379 (GRCm39) T1540K probably benign Het
Zc2hc1c C T 12: 85,343,386 (GRCm39) H508Y probably damaging Het
Zfp407 A T 18: 84,579,310 (GRCm39) M601K probably damaging Het
Zfp951 A T 5: 104,963,169 (GRCm39) Y132* probably null Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 62,411,680 (GRCm39) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 62,440,465 (GRCm39) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 62,422,617 (GRCm39) missense probably benign 0.18
IGL01023:Ddx60 APN 8 62,395,548 (GRCm39) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 62,435,560 (GRCm39) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 62,416,774 (GRCm39) missense probably null 0.81
IGL01733:Ddx60 APN 8 62,436,899 (GRCm39) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,470,857 (GRCm39) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,453,743 (GRCm39) splice site probably benign
IGL02110:Ddx60 APN 8 62,470,281 (GRCm39) critical splice donor site probably null
IGL02302:Ddx60 APN 8 62,428,866 (GRCm39) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 62,411,676 (GRCm39) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,477,985 (GRCm39) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 62,395,470 (GRCm39) splice site probably null
IGL02657:Ddx60 APN 8 62,437,149 (GRCm39) missense probably benign 0.01
IGL02677:Ddx60 APN 8 62,441,166 (GRCm39) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 62,432,375 (GRCm39) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 62,409,156 (GRCm39) missense probably benign 0.00
IGL03137:Ddx60 APN 8 62,441,117 (GRCm39) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 62,409,155 (GRCm39) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,465,483 (GRCm39) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 62,430,916 (GRCm39) critical splice acceptor site probably null
Scatter UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
shotgun UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
splay UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 62,411,147 (GRCm39) missense probably benign
PIT4677001:Ddx60 UTSW 8 62,425,288 (GRCm39) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 62,395,327 (GRCm39) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,486,527 (GRCm39) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 62,436,889 (GRCm39) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,470,783 (GRCm39) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 62,447,575 (GRCm39) splice site probably benign
R0479:Ddx60 UTSW 8 62,422,691 (GRCm39) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,470,828 (GRCm39) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 62,440,395 (GRCm39) missense probably benign 0.27
R1119:Ddx60 UTSW 8 62,395,578 (GRCm39) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 62,411,193 (GRCm39) splice site probably benign
R1778:Ddx60 UTSW 8 62,427,210 (GRCm39) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 62,422,587 (GRCm39) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 62,401,903 (GRCm39) missense probably benign 0.10
R1970:Ddx60 UTSW 8 62,425,240 (GRCm39) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 62,393,679 (GRCm39) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,470,234 (GRCm39) missense probably benign 0.01
R2174:Ddx60 UTSW 8 62,409,175 (GRCm39) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 62,411,097 (GRCm39) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,490,125 (GRCm39) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,465,470 (GRCm39) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,490,122 (GRCm39) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 62,409,178 (GRCm39) missense probably benign 0.25
R4010:Ddx60 UTSW 8 62,407,569 (GRCm39) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 62,425,254 (GRCm39) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 62,447,427 (GRCm39) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 62,402,012 (GRCm39) splice site probably null
R4561:Ddx60 UTSW 8 62,395,495 (GRCm39) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 62,440,455 (GRCm39) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,476,295 (GRCm39) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,465,458 (GRCm39) missense probably benign 0.01
R4807:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 62,398,940 (GRCm39) missense probably benign 0.01
R5187:Ddx60 UTSW 8 62,427,222 (GRCm39) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 62,437,192 (GRCm39) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,463,036 (GRCm39) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 62,403,485 (GRCm39) missense probably benign 0.28
R5514:Ddx60 UTSW 8 62,411,091 (GRCm39) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,453,612 (GRCm39) missense probably benign 0.38
R5742:Ddx60 UTSW 8 62,401,955 (GRCm39) missense probably benign
R5772:Ddx60 UTSW 8 62,401,931 (GRCm39) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,465,422 (GRCm39) nonsense probably null
R5815:Ddx60 UTSW 8 62,416,756 (GRCm39) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 62,409,155 (GRCm39) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 62,393,774 (GRCm39) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,474,444 (GRCm39) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,453,616 (GRCm39) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,476,275 (GRCm39) missense probably null 0.01
R6153:Ddx60 UTSW 8 62,398,974 (GRCm39) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 62,403,612 (GRCm39) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 62,436,939 (GRCm39) missense probably benign 0.00
R6416:Ddx60 UTSW 8 62,451,715 (GRCm39) missense probably benign
R6416:Ddx60 UTSW 8 62,430,984 (GRCm39) missense probably benign 0.00
R6660:Ddx60 UTSW 8 62,409,273 (GRCm39) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 62,436,924 (GRCm39) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,453,723 (GRCm39) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,490,103 (GRCm39) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 62,441,142 (GRCm39) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R7409:Ddx60 UTSW 8 62,411,612 (GRCm39) missense probably benign 0.24
R7464:Ddx60 UTSW 8 62,393,708 (GRCm39) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 62,428,826 (GRCm39) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 62,430,924 (GRCm39) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 62,407,569 (GRCm39) missense probably benign 0.03
R8124:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8126:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8155:Ddx60 UTSW 8 62,470,205 (GRCm39) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,470,284 (GRCm39) splice site probably null
R8192:Ddx60 UTSW 8 62,431,002 (GRCm39) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
R8304:Ddx60 UTSW 8 62,451,803 (GRCm39) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 62,395,669 (GRCm39) critical splice donor site probably null
R8374:Ddx60 UTSW 8 62,427,205 (GRCm39) missense probably benign 0.01
R8401:Ddx60 UTSW 8 62,409,277 (GRCm39) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 62,427,184 (GRCm39) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 62,411,640 (GRCm39) missense probably benign 0.27
R8826:Ddx60 UTSW 8 62,398,990 (GRCm39) missense probably benign 0.02
R8829:Ddx60 UTSW 8 62,393,695 (GRCm39) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 62,447,553 (GRCm39) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 62,427,168 (GRCm39) nonsense probably null
R9122:Ddx60 UTSW 8 62,442,898 (GRCm39) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,470,875 (GRCm39) missense probably benign 0.36
R9278:Ddx60 UTSW 8 62,431,012 (GRCm39) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,462,994 (GRCm39) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 62,425,248 (GRCm39) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,465,312 (GRCm39) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,486,451 (GRCm39) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 62,416,726 (GRCm39) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,453,622 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTAGTGGCTGATCTATGCTATGC -3'
(R):5'- TCTCCATAGAGCACTGGAGG -3'

Sequencing Primer
(F):5'- ATGGCTCCATGGAGTTCAAC -3'
(R):5'- GGGGGAAGGTGAGATTTTCCAAATG -3'
Posted On 2020-06-30