Incidental Mutation 'R8125:Csnk2a2'
ID631706
Institutional Source Beutler Lab
Gene Symbol Csnk2a2
Ensembl Gene ENSMUSG00000046707
Gene Namecasein kinase 2, alpha prime polypeptide
SynonymsCK2, 1110035J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R8125 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location95446096-95490039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95455947 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 296 (P296L)
Ref Sequence ENSEMBL: ENSMUSP00000055919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056919] [ENSMUST00000212214] [ENSMUST00000212952]
Predicted Effect
SMART Domains Protein: ENSMUSP00000055919
Gene: ENSMUSG00000046707
AA Change: P296L

DomainStartEndE-ValueType
S_TKc 40 325 1.85e-77 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212441
Predicted Effect
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000212952
AA Change: P201L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Males homozygotes for a targeted null mutation of the minor catalytic subunit exhibit infertility with oligospermia and abnormally shaped spermatid nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,475,652 T143K probably benign Het
4933434E20Rik T A 3: 90,065,511 V74D possibly damaging Het
Acot11 C T 4: 106,760,080 probably null Het
Adam20 A T 8: 40,794,936 I28L probably benign Het
Adamtsl3 A G 7: 82,450,333 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak C T 19: 9,011,876 A3508V possibly damaging Het
Arhgap20 T C 9: 51,826,909 I235T probably damaging Het
B4galnt3 T C 6: 120,224,593 T164A probably damaging Het
Brip1 A G 11: 86,186,991 S204P possibly damaging Het
Ccdc185 C A 1: 182,747,270 S618I probably benign Het
Ckap5 T A 2: 91,576,269 I805K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cmtm2a A T 8: 104,292,711 I82N probably damaging Het
Corin T A 5: 72,358,463 H416L probably damaging Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Dchs1 T C 7: 105,764,882 T909A possibly damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dmbt1 A G 7: 131,099,223 T1218A unknown Het
E330021D16Rik T G 6: 136,401,186 R215S possibly damaging Het
Ebf1 T C 11: 44,972,915 I364T probably damaging Het
Efcab10 C A 12: 33,398,314 R49S probably damaging Het
Eif2b1 G A 5: 124,579,099 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam205c A G 4: 42,873,051 L80P probably damaging Het
Gm49358 T A 10: 86,820,993 F273Y Het
Gria2 T A 3: 80,707,243 I497F possibly damaging Het
Ipo9 T C 1: 135,403,340 T426A probably benign Het
Klhl11 T C 11: 100,463,985 I337V probably benign Het
Krtap19-5 A T 16: 88,896,348 Y25* probably null Het
Lamb2 T G 9: 108,487,523 S1159A probably benign Het
Mpig6b A T 17: 35,065,352 L154Q probably damaging Het
Mrpl28 T C 17: 26,124,620 I118T probably damaging Het
Msh3 A T 13: 92,299,182 N536K probably benign Het
Myh8 A G 11: 67,299,772 K1308E possibly damaging Het
Nav3 C A 10: 109,852,659 G586W probably damaging Het
Ncoa7 T C 10: 30,694,091 K291E possibly damaging Het
Nr5a1 C T 2: 38,701,981 V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,578,237 probably null Het
Olfr1284 T C 2: 111,379,741 V247A probably damaging Het
Olfr1291-ps1 A T 2: 111,499,987 D245V possibly damaging Het
Olfr99 A T 17: 37,280,044 H125Q probably benign Het
Pard3b T C 1: 61,767,984 Y53H probably damaging Het
Pcyox1l G A 18: 61,707,505 P26L unknown Het
Pdzrn4 A G 15: 92,743,595 S391G probably damaging Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Pibf1 C T 14: 99,179,367 Q459* probably null Het
Pkd1l1 C T 11: 8,947,241 C556Y probably damaging Het
Plin1 A G 7: 79,729,851 F84L possibly damaging Het
Rasa3 A G 8: 13,577,801 probably null Het
Sdc1 G A 12: 8,790,663 V143I probably benign Het
Skor2 C A 18: 76,859,678 A365E unknown Het
Slc16a7 A G 10: 125,328,333 probably null Het
Slc25a31 T A 3: 40,709,143 V51E probably damaging Het
Slc6a6 C A 6: 91,726,106 F153L probably damaging Het
Snx7 T A 3: 117,837,245 K238M probably damaging Het
Soga3 T C 10: 29,196,898 S729P probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Sphkap T G 1: 83,263,582 Q1587P probably damaging Het
Tcte1 T C 17: 45,539,692 I298T possibly damaging Het
Tmem247 A G 17: 86,922,367 Y120C Het
Togaram2 C G 17: 71,716,494 L802V probably benign Het
Trim32 T C 4: 65,613,962 V252A probably benign Het
Ttc37 T C 13: 76,130,327 probably null Het
Vat1 T C 11: 101,460,203 K404R probably benign Het
Xirp2 C A 2: 67,512,035 T1540K probably benign Het
Zc2hc1c C T 12: 85,296,612 H508Y probably damaging Het
Zfp407 A T 18: 84,561,185 M601K probably damaging Het
Zfp951 A T 5: 104,815,303 Y132* probably null Het
Other mutations in Csnk2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Csnk2a2 APN 8 95477231 missense possibly damaging 0.87
R1452:Csnk2a2 UTSW 8 95457375 splice site probably benign
R1717:Csnk2a2 UTSW 8 95455808 splice site probably null
R4260:Csnk2a2 UTSW 8 95457399 missense probably benign 0.01
R6062:Csnk2a2 UTSW 8 95457469 missense possibly damaging 0.93
R7169:Csnk2a2 UTSW 8 95488378 missense
R8124:Csnk2a2 UTSW 8 95455947 missense
R8126:Csnk2a2 UTSW 8 95455947 missense
R8253:Csnk2a2 UTSW 8 95488377 missense
Predicted Primers PCR Primer
(F):5'- TGTCTTTTAATAACTCACAGGGCTG -3'
(R):5'- CTTCACAGTGCACCGTTCTAAG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CACCGTTCTAAGGGGTCCTTG -3'
Posted On2020-06-30