Incidental Mutation 'R8125:Pfn4'
ID631722
Institutional Source Beutler Lab
Gene Symbol Pfn4
Ensembl Gene ENSMUSG00000020639
Gene Nameprofilin family, member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8125 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4769022-4778813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4775487 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 108 (M108K)
Ref Sequence ENSEMBL: ENSMUSP00000136765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020967] [ENSMUST00000178879] [ENSMUST00000219438] [ENSMUST00000219503]
Predicted Effect probably damaging
Transcript: ENSMUST00000020967
AA Change: M108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020967
Gene: ENSMUSG00000020639
AA Change: M108K

DomainStartEndE-ValueType
Pfam:Profilin 4 124 5.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178879
AA Change: M108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136765
Gene: ENSMUSG00000020639
AA Change: M108K

DomainStartEndE-ValueType
Pfam:Profilin 5 124 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219438
Predicted Effect probably damaging
Transcript: ENSMUST00000219503
AA Change: M108K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6360 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,475,652 T143K probably benign Het
4933434E20Rik T A 3: 90,065,511 V74D possibly damaging Het
Acot11 C T 4: 106,760,080 probably null Het
Adam20 A T 8: 40,794,936 I28L probably benign Het
Adamtsl3 A G 7: 82,450,333 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak C T 19: 9,011,876 A3508V possibly damaging Het
Arhgap20 T C 9: 51,826,909 I235T probably damaging Het
B4galnt3 T C 6: 120,224,593 T164A probably damaging Het
Brip1 A G 11: 86,186,991 S204P possibly damaging Het
Ccdc185 C A 1: 182,747,270 S618I probably benign Het
Ckap5 T A 2: 91,576,269 I805K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cmtm2a A T 8: 104,292,711 I82N probably damaging Het
Corin T A 5: 72,358,463 H416L probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Dchs1 T C 7: 105,764,882 T909A possibly damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dmbt1 A G 7: 131,099,223 T1218A unknown Het
E330021D16Rik T G 6: 136,401,186 R215S possibly damaging Het
Ebf1 T C 11: 44,972,915 I364T probably damaging Het
Efcab10 C A 12: 33,398,314 R49S probably damaging Het
Eif2b1 G A 5: 124,579,099 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam205c A G 4: 42,873,051 L80P probably damaging Het
Gm49358 T A 10: 86,820,993 F273Y Het
Gria2 T A 3: 80,707,243 I497F possibly damaging Het
Ipo9 T C 1: 135,403,340 T426A probably benign Het
Klhl11 T C 11: 100,463,985 I337V probably benign Het
Krtap19-5 A T 16: 88,896,348 Y25* probably null Het
Lamb2 T G 9: 108,487,523 S1159A probably benign Het
Mpig6b A T 17: 35,065,352 L154Q probably damaging Het
Mrpl28 T C 17: 26,124,620 I118T probably damaging Het
Msh3 A T 13: 92,299,182 N536K probably benign Het
Myh8 A G 11: 67,299,772 K1308E possibly damaging Het
Nav3 C A 10: 109,852,659 G586W probably damaging Het
Ncoa7 T C 10: 30,694,091 K291E possibly damaging Het
Nr5a1 C T 2: 38,701,981 V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,578,237 probably null Het
Olfr1284 T C 2: 111,379,741 V247A probably damaging Het
Olfr1291-ps1 A T 2: 111,499,987 D245V possibly damaging Het
Olfr99 A T 17: 37,280,044 H125Q probably benign Het
Pard3b T C 1: 61,767,984 Y53H probably damaging Het
Pcyox1l G A 18: 61,707,505 P26L unknown Het
Pdzrn4 A G 15: 92,743,595 S391G probably damaging Het
Pibf1 C T 14: 99,179,367 Q459* probably null Het
Pkd1l1 C T 11: 8,947,241 C556Y probably damaging Het
Plin1 A G 7: 79,729,851 F84L possibly damaging Het
Rasa3 A G 8: 13,577,801 probably null Het
Sdc1 G A 12: 8,790,663 V143I probably benign Het
Skor2 C A 18: 76,859,678 A365E unknown Het
Slc16a7 A G 10: 125,328,333 probably null Het
Slc25a31 T A 3: 40,709,143 V51E probably damaging Het
Slc6a6 C A 6: 91,726,106 F153L probably damaging Het
Snx7 T A 3: 117,837,245 K238M probably damaging Het
Soga3 T C 10: 29,196,898 S729P probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Sphkap T G 1: 83,263,582 Q1587P probably damaging Het
Tcte1 T C 17: 45,539,692 I298T possibly damaging Het
Tmem247 A G 17: 86,922,367 Y120C Het
Togaram2 C G 17: 71,716,494 L802V probably benign Het
Trim32 T C 4: 65,613,962 V252A probably benign Het
Ttc37 T C 13: 76,130,327 probably null Het
Vat1 T C 11: 101,460,203 K404R probably benign Het
Xirp2 C A 2: 67,512,035 T1540K probably benign Het
Zc2hc1c C T 12: 85,296,612 H508Y probably damaging Het
Zfp407 A T 18: 84,561,185 M601K probably damaging Het
Zfp951 A T 5: 104,815,303 Y132* probably null Het
Other mutations in Pfn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Pfn4 APN 12 4775505 missense probably damaging 1.00
IGL01522:Pfn4 APN 12 4770240 missense probably benign 0.01
IGL01726:Pfn4 APN 12 4774446 missense probably benign 0.00
IGL02896:Pfn4 APN 12 4775451 missense probably benign 0.02
R2082:Pfn4 UTSW 12 4775439 splice site probably null
R2201:Pfn4 UTSW 12 4774382 splice site probably null
R4373:Pfn4 UTSW 12 4770182 missense probably damaging 0.99
R4376:Pfn4 UTSW 12 4770182 missense probably damaging 0.99
R4377:Pfn4 UTSW 12 4770182 missense probably damaging 0.99
R4692:Pfn4 UTSW 12 4774486 missense probably damaging 1.00
R6762:Pfn4 UTSW 12 4775487 missense probably damaging 1.00
R7711:Pfn4 UTSW 12 4774414 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGATACACGCCATGAAGCCG -3'
(R):5'- CCCAGTAGTGCTCTCATACG -3'

Sequencing Primer
(F):5'- CCCCTGTTAGGCACAAGAGTTATG -3'
(R):5'- TAGTGCTCTCATACGCGGCAC -3'
Posted On2020-06-30