Incidental Mutation 'R8125:Adgrv1'
ID 631728
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Name adhesion G protein-coupled receptor V1
Synonyms Mass1, Mgr1, VLGR1, Gpr98
MMRRC Submission 067554-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8125 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 81243187-81781273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81588344 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 4414 (V4414E)
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000095585
AA Change: V4414E

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: V4414E

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120136
Gene: ENSMUSG00000069170
AA Change: V109E

DomainStartEndE-ValueType
Pfam:Calx-beta 1 47 2e-9 PFAM
Pfam:Calx-beta 79 180 4e-11 PFAM
Pfam:Calx-beta 194 304 9.2e-4 PFAM
Pfam:Calx-beta 354 425 2.9e-3 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,608,709 (GRCm39) T143K probably benign Het
4933434E20Rik T A 3: 89,972,818 (GRCm39) V74D possibly damaging Het
Acot11 C T 4: 106,617,277 (GRCm39) probably null Het
Adam20 A T 8: 41,247,973 (GRCm39) I28L probably benign Het
Adamtsl3 A G 7: 82,099,541 (GRCm39) probably null Het
Ahnak C T 19: 8,989,240 (GRCm39) A3508V possibly damaging Het
Arhgap20 T C 9: 51,738,209 (GRCm39) I235T probably damaging Het
B4galnt3 T C 6: 120,201,554 (GRCm39) T164A probably damaging Het
Brip1 A G 11: 86,077,817 (GRCm39) S204P possibly damaging Het
Ccdc185 C A 1: 182,574,835 (GRCm39) S618I probably benign Het
Ckap5 T A 2: 91,406,614 (GRCm39) I805K probably damaging Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cmtm2a A T 8: 105,019,343 (GRCm39) I82N probably damaging Het
Corin T A 5: 72,515,806 (GRCm39) H416L probably damaging Het
Csnk2a2 G A 8: 96,182,575 (GRCm39) P296L Het
Cygb T A 11: 116,540,116 (GRCm39) T178S probably benign Het
Dchs1 T C 7: 105,414,089 (GRCm39) T909A possibly damaging Het
Ddx60 C T 8: 62,436,945 (GRCm39) A965V probably benign Het
Dmbt1 A G 7: 130,700,953 (GRCm39) T1218A unknown Het
Ebf1 T C 11: 44,863,742 (GRCm39) I364T probably damaging Het
Efcab10 C A 12: 33,448,313 (GRCm39) R49S probably damaging Het
Eif2b1 G A 5: 124,717,162 (GRCm39) probably benign Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Gm49358 T A 10: 86,656,857 (GRCm39) F273Y Het
Gria2 T A 3: 80,614,550 (GRCm39) I497F possibly damaging Het
Ipo9 T C 1: 135,331,078 (GRCm39) T426A probably benign Het
Klhl11 T C 11: 100,354,811 (GRCm39) I337V probably benign Het
Krtap19-5 A T 16: 88,693,236 (GRCm39) Y25* probably null Het
Lamb2 T G 9: 108,364,722 (GRCm39) S1159A probably benign Het
Mpig6b A T 17: 35,284,328 (GRCm39) L154Q probably damaging Het
Mrpl28 T C 17: 26,343,594 (GRCm39) I118T probably damaging Het
Msh3 A T 13: 92,435,690 (GRCm39) N536K probably benign Het
Mtcl3 T C 10: 29,072,894 (GRCm39) S729P probably damaging Het
Myh8 A G 11: 67,190,598 (GRCm39) K1308E possibly damaging Het
Nav3 C A 10: 109,688,520 (GRCm39) G586W probably damaging Het
Ncoa7 T C 10: 30,570,087 (GRCm39) K291E possibly damaging Het
Nr5a1 C T 2: 38,591,993 (GRCm39) V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,469,063 (GRCm39) probably null Het
Or1o4 A T 17: 37,590,935 (GRCm39) H125Q probably benign Het
Or4f4-ps1 A T 2: 111,330,332 (GRCm39) D245V possibly damaging Het
Or4g17 T C 2: 111,210,086 (GRCm39) V247A probably damaging Het
Pard3b T C 1: 61,807,143 (GRCm39) Y53H probably damaging Het
Pcyox1l G A 18: 61,840,576 (GRCm39) P26L unknown Het
Pdzrn4 A G 15: 92,641,476 (GRCm39) S391G probably damaging Het
Pfn4 T A 12: 4,825,487 (GRCm39) M108K probably damaging Het
Pibf1 C T 14: 99,416,803 (GRCm39) Q459* probably null Het
Pkd1l1 C T 11: 8,897,241 (GRCm39) C556Y probably damaging Het
Plin1 A G 7: 79,379,599 (GRCm39) F84L possibly damaging Het
Rasa3 A G 8: 13,627,801 (GRCm39) probably null Het
Sdc1 G A 12: 8,840,663 (GRCm39) V143I probably benign Het
Skic3 T C 13: 76,278,446 (GRCm39) probably null Het
Skor2 C A 18: 76,947,373 (GRCm39) A365E unknown Het
Slc16a7 A G 10: 125,164,202 (GRCm39) probably null Het
Slc25a31 T A 3: 40,663,573 (GRCm39) V51E probably damaging Het
Slc6a6 C A 6: 91,703,087 (GRCm39) F153L probably damaging Het
Snx7 T A 3: 117,630,894 (GRCm39) K238M probably damaging Het
Spata3 C T 1: 85,952,075 (GRCm39) R110C unknown Het
Spata31f3 A G 4: 42,873,051 (GRCm39) L80P probably damaging Het
Sphkap T G 1: 83,241,303 (GRCm39) Q1587P probably damaging Het
Tcte1 T C 17: 45,850,618 (GRCm39) I298T possibly damaging Het
Tmem247 A G 17: 87,229,795 (GRCm39) Y120C Het
Togaram2 C G 17: 72,023,489 (GRCm39) L802V probably benign Het
Trim32 T C 4: 65,532,199 (GRCm39) V252A probably benign Het
Ube2q2l T G 6: 136,378,184 (GRCm39) R215S possibly damaging Het
Vat1 T C 11: 101,351,029 (GRCm39) K404R probably benign Het
Xirp2 C A 2: 67,342,379 (GRCm39) T1540K probably benign Het
Zc2hc1c C T 12: 85,343,386 (GRCm39) H508Y probably damaging Het
Zfp407 A T 18: 84,579,310 (GRCm39) M601K probably damaging Het
Zfp951 A T 5: 104,963,169 (GRCm39) Y132* probably null Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81,553,527 (GRCm39) critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81,620,996 (GRCm39) splice site probably benign
IGL00471:Adgrv1 APN 13 81,657,661 (GRCm39) missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81,637,193 (GRCm39) missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81,654,306 (GRCm39) missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81,672,803 (GRCm39) missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81,726,349 (GRCm39) missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81,545,322 (GRCm39) missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81,688,238 (GRCm39) missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81,530,410 (GRCm39) missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81,637,147 (GRCm39) missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81,567,470 (GRCm39) missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81,553,518 (GRCm39) missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81,567,247 (GRCm39) missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81,705,184 (GRCm39) missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81,705,277 (GRCm39) missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81,614,303 (GRCm39) missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81,567,750 (GRCm39) missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81,715,461 (GRCm39) missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81,677,168 (GRCm39) missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81,620,513 (GRCm39) critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81,330,902 (GRCm39) missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81,594,549 (GRCm39) missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81,705,428 (GRCm39) missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81,705,115 (GRCm39) missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81,716,862 (GRCm39) splice site probably benign
IGL02016:Adgrv1 APN 13 81,545,572 (GRCm39) missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81,727,909 (GRCm39) missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81,575,783 (GRCm39) missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81,707,314 (GRCm39) splice site probably null
IGL02328:Adgrv1 APN 13 81,726,294 (GRCm39) missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81,607,832 (GRCm39) missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81,707,543 (GRCm39) missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81,627,789 (GRCm39) missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81,583,675 (GRCm39) splice site probably benign
IGL02603:Adgrv1 APN 13 81,637,071 (GRCm39) missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81,659,738 (GRCm39) missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81,726,991 (GRCm39) missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81,711,851 (GRCm39) missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81,668,858 (GRCm39) missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81,727,833 (GRCm39) missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81,581,755 (GRCm39) missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81,671,731 (GRCm39) missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81,726,973 (GRCm39) missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81,590,599 (GRCm39) missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81,621,018 (GRCm39) missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81,707,648 (GRCm39) missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81,581,819 (GRCm39) missense probably benign 0.02
IGL03119:Adgrv1 APN 13 81,530,492 (GRCm39) missense probably damaging 1.00
IGL03169:Adgrv1 APN 13 81,652,019 (GRCm39) missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81,581,737 (GRCm39) missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81,594,597 (GRCm39) missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81,255,017 (GRCm39) splice site probably null
IGL03343:Adgrv1 APN 13 81,431,507 (GRCm39) missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81,647,177 (GRCm39) missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81,629,455 (GRCm39) missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81,711,751 (GRCm39) missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81,666,086 (GRCm39) missense probably damaging 0.99
abetting UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
beatle UTSW 13 81,727,713 (GRCm39) nonsense probably null
Escape UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
lento UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
Metronome UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
Murderous UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
Nome UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
Propulsion UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
revulsion UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
Saturnv UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
Thrust UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
Velocity UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
Wilting UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
Withering UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81,568,125 (GRCm39) missense probably benign 0.13
G1patch:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
G1patch:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
I2288:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81,677,104 (GRCm39) missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81,707,471 (GRCm39) missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0087:Adgrv1 UTSW 13 81,535,070 (GRCm39) missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0131:Adgrv1 UTSW 13 81,651,114 (GRCm39) unclassified probably benign
R0218:Adgrv1 UTSW 13 81,255,017 (GRCm39) splice site probably null
R0325:Adgrv1 UTSW 13 81,688,134 (GRCm39) missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81,623,112 (GRCm39) missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81,534,072 (GRCm39) missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81,545,345 (GRCm39) nonsense probably null
R0466:Adgrv1 UTSW 13 81,714,415 (GRCm39) missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81,637,154 (GRCm39) missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81,707,269 (GRCm39) missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81,676,561 (GRCm39) splice site probably benign
R0532:Adgrv1 UTSW 13 81,727,015 (GRCm39) missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81,721,437 (GRCm39) missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81,676,649 (GRCm39) missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81,623,224 (GRCm39) missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81,651,123 (GRCm39) missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81,718,675 (GRCm39) missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81,647,244 (GRCm39) missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81,627,861 (GRCm39) nonsense probably null
R0962:Adgrv1 UTSW 13 81,553,465 (GRCm39) missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81,705,182 (GRCm39) missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81,588,156 (GRCm39) splice site probably benign
R1310:Adgrv1 UTSW 13 81,714,496 (GRCm39) missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81,676,984 (GRCm39) missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81,641,295 (GRCm39) missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81,534,907 (GRCm39) missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81,243,569 (GRCm39) missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81,581,632 (GRCm39) missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81,727,738 (GRCm39) missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81,620,699 (GRCm39) critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81,705,076 (GRCm39) missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81,741,167 (GRCm39) missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81,652,097 (GRCm39) splice site probably null
R1579:Adgrv1 UTSW 13 81,711,898 (GRCm39) missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81,614,279 (GRCm39) critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81,707,236 (GRCm39) missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81,572,407 (GRCm39) missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81,635,972 (GRCm39) missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81,624,750 (GRCm39) missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81,707,671 (GRCm39) missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81,741,179 (GRCm39) missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81,636,066 (GRCm39) missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81,654,265 (GRCm39) missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81,637,196 (GRCm39) missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81,652,232 (GRCm39) missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81,692,652 (GRCm39) missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81,711,685 (GRCm39) missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81,740,670 (GRCm39) splice site probably benign
R1928:Adgrv1 UTSW 13 81,668,905 (GRCm39) missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81,539,876 (GRCm39) missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81,659,030 (GRCm39) missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81,671,868 (GRCm39) missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81,709,588 (GRCm39) missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81,677,132 (GRCm39) missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81,640,656 (GRCm39) missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81,568,069 (GRCm39) missense probably benign 0.02
R2125:Adgrv1 UTSW 13 81,567,654 (GRCm39) missense probably benign 0.00
R2127:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81,729,846 (GRCm39) missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81,672,676 (GRCm39) critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81,593,439 (GRCm39) missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81,714,409 (GRCm39) missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81,654,259 (GRCm39) missense probably benign
R2260:Adgrv1 UTSW 13 81,716,493 (GRCm39) missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81,743,298 (GRCm39) missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R2910:Adgrv1 UTSW 13 81,705,238 (GRCm39) missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81,596,984 (GRCm39) missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81,729,866 (GRCm39) missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81,691,661 (GRCm39) missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81,672,719 (GRCm39) missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81,567,594 (GRCm39) missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81,647,162 (GRCm39) missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81,741,221 (GRCm39) missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81,431,486 (GRCm39) start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81,588,191 (GRCm39) missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81,726,891 (GRCm39) missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81,330,908 (GRCm39) missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4003:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4194:Adgrv1 UTSW 13 81,647,115 (GRCm39) missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81,588,311 (GRCm39) missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81,641,029 (GRCm39) missense unknown
R4388:Adgrv1 UTSW 13 81,729,828 (GRCm39) missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81,714,421 (GRCm39) missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81,567,349 (GRCm39) missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81,588,185 (GRCm39) missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81,567,927 (GRCm39) missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81,642,688 (GRCm39) splice site probably null
R4647:Adgrv1 UTSW 13 81,676,914 (GRCm39) nonsense probably null
R4657:Adgrv1 UTSW 13 81,553,483 (GRCm39) missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81,581,644 (GRCm39) missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81,255,038 (GRCm39) missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81,243,564 (GRCm39) missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81,303,350 (GRCm39) nonsense probably null
R4816:Adgrv1 UTSW 13 81,676,793 (GRCm39) missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81,708,963 (GRCm39) missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81,651,120 (GRCm39) critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81,681,241 (GRCm39) intron probably benign
R4897:Adgrv1 UTSW 13 81,709,704 (GRCm39) splice site probably null
R4906:Adgrv1 UTSW 13 81,418,857 (GRCm39) splice site probably null
R4917:Adgrv1 UTSW 13 81,658,996 (GRCm39) missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81,726,853 (GRCm39) missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81,607,948 (GRCm39) missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81,637,050 (GRCm39) missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81,676,940 (GRCm39) missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81,740,704 (GRCm39) missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81,243,606 (GRCm39) missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81,567,546 (GRCm39) missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81,587,560 (GRCm39) missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81,583,793 (GRCm39) missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81,431,535 (GRCm39) start gained probably benign
R5203:Adgrv1 UTSW 13 81,659,024 (GRCm39) missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81,637,048 (GRCm39) nonsense probably null
R5280:Adgrv1 UTSW 13 81,545,584 (GRCm39) missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81,669,203 (GRCm39) missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81,726,372 (GRCm39) missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81,624,809 (GRCm39) missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81,677,165 (GRCm39) missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81,607,834 (GRCm39) missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81,567,427 (GRCm39) missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81,572,377 (GRCm39) missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81,593,363 (GRCm39) missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81,567,508 (GRCm39) missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81,581,808 (GRCm39) missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81,624,683 (GRCm39) missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81,553,386 (GRCm39) missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81,303,395 (GRCm39) missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81,669,236 (GRCm39) missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81,620,619 (GRCm39) missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81,670,355 (GRCm39) missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81,251,421 (GRCm39) missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81,572,390 (GRCm39) missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81,545,570 (GRCm39) missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81,255,194 (GRCm39) missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81,534,985 (GRCm39) missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81,590,620 (GRCm39) missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81,614,378 (GRCm39) missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81,545,542 (GRCm39) nonsense probably null
R6024:Adgrv1 UTSW 13 81,624,624 (GRCm39) missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81,539,814 (GRCm39) missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81,575,864 (GRCm39) missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81,654,195 (GRCm39) missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81,330,893 (GRCm39) missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81,567,378 (GRCm39) missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81,534,124 (GRCm39) missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81,581,957 (GRCm39) missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81,672,898 (GRCm39) splice site probably null
R6190:Adgrv1 UTSW 13 81,607,882 (GRCm39) splice site probably null
R6215:Adgrv1 UTSW 13 81,727,713 (GRCm39) nonsense probably null
R6216:Adgrv1 UTSW 13 81,672,590 (GRCm39) splice site probably null
R6238:Adgrv1 UTSW 13 81,614,402 (GRCm39) missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81,255,050 (GRCm39) missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81,647,187 (GRCm39) missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81,534,100 (GRCm39) missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81,562,702 (GRCm39) missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81,656,855 (GRCm39) missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81,723,220 (GRCm39) splice site probably null
R6467:Adgrv1 UTSW 13 81,592,657 (GRCm39) missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81,707,609 (GRCm39) missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81,715,462 (GRCm39) missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81,581,771 (GRCm39) missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81,654,298 (GRCm39) missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81,636,081 (GRCm39) missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81,629,634 (GRCm39) missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81,620,597 (GRCm39) missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81,621,072 (GRCm39) missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81,705,200 (GRCm39) missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81,303,273 (GRCm39) critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81,581,613 (GRCm39) missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81,676,820 (GRCm39) missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81,656,788 (GRCm39) missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81,715,609 (GRCm39) missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81,669,116 (GRCm39) missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81,670,223 (GRCm39) critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81,709,593 (GRCm39) missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81,726,261 (GRCm39) missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
R7168:Adgrv1 UTSW 13 81,545,328 (GRCm39) missense possibly damaging 0.52
R7205:Adgrv1 UTSW 13 81,627,777 (GRCm39) missense probably benign 0.00
R7239:Adgrv1 UTSW 13 81,624,731 (GRCm39) missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81,522,378 (GRCm39) missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81,668,634 (GRCm39) missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81,708,808 (GRCm39) missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81,707,467 (GRCm39) missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81,711,738 (GRCm39) missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81,647,192 (GRCm39) missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81,727,596 (GRCm39) missense probably damaging 1.00
R7567:Adgrv1 UTSW 13 81,581,648 (GRCm39) missense probably benign 0.00
R7614:Adgrv1 UTSW 13 81,668,780 (GRCm39) missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81,570,344 (GRCm39) missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81,647,261 (GRCm39) missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
R7788:Adgrv1 UTSW 13 81,721,433 (GRCm39) missense probably damaging 1.00
R7809:Adgrv1 UTSW 13 81,676,760 (GRCm39) missense possibly damaging 0.81
R7854:Adgrv1 UTSW 13 81,741,207 (GRCm39) missense probably damaging 1.00
R7894:Adgrv1 UTSW 13 81,715,570 (GRCm39) missense probably benign 0.00
R7948:Adgrv1 UTSW 13 81,707,707 (GRCm39) missense probably damaging 1.00
R7948:Adgrv1 UTSW 13 81,707,648 (GRCm39) missense probably damaging 1.00
R7949:Adgrv1 UTSW 13 81,303,353 (GRCm39) missense probably damaging 1.00
R7951:Adgrv1 UTSW 13 81,711,689 (GRCm39) missense probably damaging 1.00
R7968:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7969:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7973:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8007:Adgrv1 UTSW 13 81,431,585 (GRCm39) missense probably benign 0.04
R8018:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8044:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8050:Adgrv1 UTSW 13 81,561,296 (GRCm39) missense probably damaging 1.00
R8090:Adgrv1 UTSW 13 81,596,953 (GRCm39) critical splice donor site probably null
R8104:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8122:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R8122:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8123:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8126:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8212:Adgrv1 UTSW 13 81,670,240 (GRCm39) missense probably benign 0.01
R8221:Adgrv1 UTSW 13 81,677,033 (GRCm39) missense probably benign 0.00
R8256:Adgrv1 UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
R8270:Adgrv1 UTSW 13 81,651,163 (GRCm39) missense probably damaging 0.96
R8290:Adgrv1 UTSW 13 81,630,002 (GRCm39) missense probably benign 0.00
R8298:Adgrv1 UTSW 13 81,534,033 (GRCm39) nonsense probably null
R8317:Adgrv1 UTSW 13 81,723,236 (GRCm39) missense probably damaging 0.98
R8326:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8327:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8330:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8332:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8345:Adgrv1 UTSW 13 81,251,505 (GRCm39) missense probably damaging 1.00
R8398:Adgrv1 UTSW 13 81,330,797 (GRCm39) missense probably damaging 1.00
R8399:Adgrv1 UTSW 13 81,637,289 (GRCm39) missense possibly damaging 0.55
R8450:Adgrv1 UTSW 13 81,583,962 (GRCm39) splice site probably null
R8471:Adgrv1 UTSW 13 81,594,591 (GRCm39) missense probably benign 0.00
R8534:Adgrv1 UTSW 13 81,534,887 (GRCm39) missense probably benign 0.02
R8537:Adgrv1 UTSW 13 81,684,491 (GRCm39) missense probably damaging 1.00
R8703:Adgrv1 UTSW 13 81,676,792 (GRCm39) missense probably damaging 1.00
R8845:Adgrv1 UTSW 13 81,629,478 (GRCm39) missense possibly damaging 0.79
R8846:Adgrv1 UTSW 13 81,637,025 (GRCm39) critical splice donor site probably null
R8849:Adgrv1 UTSW 13 81,669,324 (GRCm39) missense probably benign
R8856:Adgrv1 UTSW 13 81,707,621 (GRCm39) missense probably benign 0.11
R8915:Adgrv1 UTSW 13 81,715,558 (GRCm39) missense probably damaging 1.00
R8963:Adgrv1 UTSW 13 81,567,588 (GRCm39) missense probably benign
R8994:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8995:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8996:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8997:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R9022:Adgrv1 UTSW 13 81,303,312 (GRCm39) missense probably damaging 1.00
R9059:Adgrv1 UTSW 13 81,562,692 (GRCm39) critical splice donor site probably null
R9076:Adgrv1 UTSW 13 81,570,247 (GRCm39) critical splice donor site probably null
R9119:Adgrv1 UTSW 13 81,658,995 (GRCm39) missense probably damaging 0.97
R9137:Adgrv1 UTSW 13 81,688,133 (GRCm39) missense probably damaging 1.00
R9146:Adgrv1 UTSW 13 81,561,291 (GRCm39) missense probably benign 0.11
R9156:Adgrv1 UTSW 13 81,669,302 (GRCm39) missense probably benign 0.00
R9163:Adgrv1 UTSW 13 81,567,541 (GRCm39) missense probably benign 0.19
R9282:Adgrv1 UTSW 13 81,251,491 (GRCm39) missense probably damaging 1.00
R9286:Adgrv1 UTSW 13 81,594,520 (GRCm39) missense probably damaging 0.98
R9328:Adgrv1 UTSW 13 81,620,523 (GRCm39) missense probably damaging 1.00
R9329:Adgrv1 UTSW 13 81,647,241 (GRCm39) missense probably damaging 1.00
R9350:Adgrv1 UTSW 13 81,654,274 (GRCm39) missense probably damaging 1.00
R9377:Adgrv1 UTSW 13 81,705,277 (GRCm39) missense probably damaging 0.99
R9394:Adgrv1 UTSW 13 81,624,767 (GRCm39) missense possibly damaging 0.95
R9419:Adgrv1 UTSW 13 81,656,887 (GRCm39) missense probably benign 0.44
R9427:Adgrv1 UTSW 13 81,732,234 (GRCm39) missense probably benign 0.00
R9429:Adgrv1 UTSW 13 81,741,165 (GRCm39) missense probably damaging 0.99
R9429:Adgrv1 UTSW 13 81,567,468 (GRCm39) missense probably damaging 1.00
R9433:Adgrv1 UTSW 13 81,714,471 (GRCm39) missense probably benign 0.02
R9434:Adgrv1 UTSW 13 81,666,292 (GRCm39) splice site probably benign
R9513:Adgrv1 UTSW 13 81,530,472 (GRCm39) missense possibly damaging 0.95
R9515:Adgrv1 UTSW 13 81,691,497 (GRCm39) missense probably damaging 0.99
R9523:Adgrv1 UTSW 13 81,567,178 (GRCm39) missense
R9525:Adgrv1 UTSW 13 81,593,453 (GRCm39) missense possibly damaging 0.77
R9576:Adgrv1 UTSW 13 81,691,608 (GRCm39) missense probably benign 0.06
R9612:Adgrv1 UTSW 13 81,641,082 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,743,371 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,670,288 (GRCm39) missense probably benign 0.01
R9702:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R9717:Adgrv1 UTSW 13 81,668,900 (GRCm39) missense probably damaging 1.00
R9720:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81,707,389 (GRCm39) missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81,535,045 (GRCm39) missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81,691,511 (GRCm39) missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81,624,791 (GRCm39) missense probably damaging 1.00
Z1176:Adgrv1 UTSW 13 81,707,753 (GRCm39) missense possibly damaging 0.90
Z1177:Adgrv1 UTSW 13 81,567,375 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CATTGTCATCGATGATGGAGAC -3'
(R):5'- GCCTGTACTAATGATTGCATAGGC -3'

Sequencing Primer
(F):5'- ACATTTATAAAGCTTAGGTTCTGTCC -3'
(R):5'- CCTCTAAATTTCAGCCTATGGTAAGC -3'
Posted On 2020-06-30