Incidental Mutation 'R8125:Pdzrn4'
ID631731
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene NamePDZ domain containing RING finger 4
Synonyms1110017D07Rik, LNX4, SAMCAP3L
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R8125 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location92396881-92771819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92743595 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 391 (S391G)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
Predicted Effect probably benign
Transcript: ENSMUST00000035399
AA Change: S152G

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: S152G

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169942
AA Change: S391G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: S391G

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik C A 18: 24,475,652 T143K probably benign Het
4933434E20Rik T A 3: 90,065,511 V74D possibly damaging Het
Acot11 C T 4: 106,760,080 probably null Het
Adam20 A T 8: 40,794,936 I28L probably benign Het
Adamtsl3 A G 7: 82,450,333 probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak C T 19: 9,011,876 A3508V possibly damaging Het
Arhgap20 T C 9: 51,826,909 I235T probably damaging Het
B4galnt3 T C 6: 120,224,593 T164A probably damaging Het
Brip1 A G 11: 86,186,991 S204P possibly damaging Het
Ccdc185 C A 1: 182,747,270 S618I probably benign Het
Ckap5 T A 2: 91,576,269 I805K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cmtm2a A T 8: 104,292,711 I82N probably damaging Het
Corin T A 5: 72,358,463 H416L probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cygb T A 11: 116,649,290 T178S probably benign Het
Dchs1 T C 7: 105,764,882 T909A possibly damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dmbt1 A G 7: 131,099,223 T1218A unknown Het
E330021D16Rik T G 6: 136,401,186 R215S possibly damaging Het
Ebf1 T C 11: 44,972,915 I364T probably damaging Het
Efcab10 C A 12: 33,398,314 R49S probably damaging Het
Eif2b1 G A 5: 124,579,099 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam205c A G 4: 42,873,051 L80P probably damaging Het
Gm49358 T A 10: 86,820,993 F273Y Het
Gria2 T A 3: 80,707,243 I497F possibly damaging Het
Ipo9 T C 1: 135,403,340 T426A probably benign Het
Klhl11 T C 11: 100,463,985 I337V probably benign Het
Krtap19-5 A T 16: 88,896,348 Y25* probably null Het
Lamb2 T G 9: 108,487,523 S1159A probably benign Het
Mpig6b A T 17: 35,065,352 L154Q probably damaging Het
Mrpl28 T C 17: 26,124,620 I118T probably damaging Het
Msh3 A T 13: 92,299,182 N536K probably benign Het
Myh8 A G 11: 67,299,772 K1308E possibly damaging Het
Nav3 C A 10: 109,852,659 G586W probably damaging Het
Ncoa7 T C 10: 30,694,091 K291E possibly damaging Het
Nr5a1 C T 2: 38,701,981 V327I probably damaging Het
Nup85 TACAAGACAA TACAA 11: 115,578,237 probably null Het
Olfr1284 T C 2: 111,379,741 V247A probably damaging Het
Olfr1291-ps1 A T 2: 111,499,987 D245V possibly damaging Het
Olfr99 A T 17: 37,280,044 H125Q probably benign Het
Pard3b T C 1: 61,767,984 Y53H probably damaging Het
Pcyox1l G A 18: 61,707,505 P26L unknown Het
Pfn4 T A 12: 4,775,487 M108K probably damaging Het
Pibf1 C T 14: 99,179,367 Q459* probably null Het
Pkd1l1 C T 11: 8,947,241 C556Y probably damaging Het
Plin1 A G 7: 79,729,851 F84L possibly damaging Het
Rasa3 A G 8: 13,577,801 probably null Het
Sdc1 G A 12: 8,790,663 V143I probably benign Het
Skor2 C A 18: 76,859,678 A365E unknown Het
Slc16a7 A G 10: 125,328,333 probably null Het
Slc25a31 T A 3: 40,709,143 V51E probably damaging Het
Slc6a6 C A 6: 91,726,106 F153L probably damaging Het
Snx7 T A 3: 117,837,245 K238M probably damaging Het
Soga3 T C 10: 29,196,898 S729P probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Sphkap T G 1: 83,263,582 Q1587P probably damaging Het
Tcte1 T C 17: 45,539,692 I298T possibly damaging Het
Tmem247 A G 17: 86,922,367 Y120C Het
Togaram2 C G 17: 71,716,494 L802V probably benign Het
Trim32 T C 4: 65,613,962 V252A probably benign Het
Ttc37 T C 13: 76,130,327 probably null Het
Vat1 T C 11: 101,460,203 K404R probably benign Het
Xirp2 C A 2: 67,512,035 T1540K probably benign Het
Zc2hc1c C T 12: 85,296,612 H508Y probably damaging Het
Zfp407 A T 18: 84,561,185 M601K probably damaging Het
Zfp951 A T 5: 104,815,303 Y132* probably null Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92746278 missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92401926 splice site probably null
IGL02103:Pdzrn4 APN 15 92769887 missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92770696 missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92769850 missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92770391 missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92769881 missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92770319 missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92757657 missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92757711 missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92770271 missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92771013 makesense probably null
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92677712 missense probably benign
R1503:Pdzrn4 UTSW 15 92399804 missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92677637 missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92770537 missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92401974 missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92746309 splice site probably null
R2061:Pdzrn4 UTSW 15 92770160 missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92769811 missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92399749 missense probably benign
R4032:Pdzrn4 UTSW 15 92769533 missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92770864 missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92402017 missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92770589 missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92769842 missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92770252 nonsense probably null
R4900:Pdzrn4 UTSW 15 92770757 missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92677621 missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92770925 missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92397374 missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92757681 missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92680537 missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92677574 missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92770422 nonsense probably null
R7096:Pdzrn4 UTSW 15 92397503 missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92770067 missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92677724 missense probably damaging 0.99
R8324:Pdzrn4 UTSW 15 92770937 missense probably damaging 1.00
X0018:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92677709 missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92680512 missense possibly damaging 0.92
X0065:Pdzrn4 UTSW 15 92397223 missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92396957 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTGTGCAAATTCATGTGAGTC -3'
(R):5'- TCAGGCCTTGGAAAAGAGGC -3'

Sequencing Primer
(F):5'- GAATGAGCTGATTTAAGTCTACGAG -3'
(R):5'- CCTTGGAAAAGAGGCTTCCC -3'
Posted On2020-06-30