Mutagenetix > Incidental Mutation

Incidental Mutation 'R8125:Pdzrn4'

631731

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R8125 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92743595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 391 (S391G)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: S152G

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: S152G

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: S391G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: S391G

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 97.0%

Validation Efficiency

100% (72/72)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	C	A	18: 24,475,652	T143K	probably benign	Het
4933434E20Rik	T	A	3: 90,065,511	V74D	possibly damaging	Het
Acot11	C	T	4: 106,760,080		probably null	Het
Adam20	A	T	8: 40,794,936	I28L	probably benign	Het
Adamtsl3	A	G	7: 82,450,333		probably null	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahnak	C	T	19: 9,011,876	A3508V	possibly damaging	Het
Arhgap20	T	C	9: 51,826,909	I235T	probably damaging	Het
B4galnt3	T	C	6: 120,224,593	T164A	probably damaging	Het
Brip1	A	G	11: 86,186,991	S204P	possibly damaging	Het
Ccdc185	C	A	1: 182,747,270	S618I	probably benign	Het
Ckap5	T	A	2: 91,576,269	I805K	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Cmtm2a	A	T	8: 104,292,711	I82N	probably damaging	Het
Corin	T	A	5: 72,358,463	H416L	probably damaging	Het
Csnk2a2	G	A	8: 95,455,947	P296L		Het
Cygb	T	A	11: 116,649,290	T178S	probably benign	Het
Dchs1	T	C	7: 105,764,882	T909A	possibly damaging	Het
Ddx60	C	T	8: 61,983,911	A965V	probably benign	Het
Dmbt1	A	G	7: 131,099,223	T1218A	unknown	Het
E330021D16Rik	T	G	6: 136,401,186	R215S	possibly damaging	Het
Ebf1	T	C	11: 44,972,915	I364T	probably damaging	Het
Efcab10	C	A	12: 33,398,314	R49S	probably damaging	Het
Eif2b1	G	A	5: 124,579,099		probably benign	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Fam205c	A	G	4: 42,873,051	L80P	probably damaging	Het
Gm49358	T	A	10: 86,820,993	F273Y		Het
Gria2	T	A	3: 80,707,243	I497F	possibly damaging	Het
Ipo9	T	C	1: 135,403,340	T426A	probably benign	Het
Klhl11	T	C	11: 100,463,985	I337V	probably benign	Het
Krtap19-5	A	T	16: 88,896,348	Y25*	probably null	Het
Lamb2	T	G	9: 108,487,523	S1159A	probably benign	Het
Mpig6b	A	T	17: 35,065,352	L154Q	probably damaging	Het
Mrpl28	T	C	17: 26,124,620	I118T	probably damaging	Het
Msh3	A	T	13: 92,299,182	N536K	probably benign	Het
Myh8	A	G	11: 67,299,772	K1308E	possibly damaging	Het
Nav3	C	A	10: 109,852,659	G586W	probably damaging	Het
Ncoa7	T	C	10: 30,694,091	K291E	possibly damaging	Het
Nr5a1	C	T	2: 38,701,981	V327I	probably damaging	Het
Nup85	TACAAGACAA	TACAA	11: 115,578,237		probably null	Het
Olfr1284	T	C	2: 111,379,741	V247A	probably damaging	Het
Olfr1291-ps1	A	T	2: 111,499,987	D245V	possibly damaging	Het
Olfr99	A	T	17: 37,280,044	H125Q	probably benign	Het
Pard3b	T	C	1: 61,767,984	Y53H	probably damaging	Het
Pcyox1l	G	A	18: 61,707,505	P26L	unknown	Het
Pfn4	T	A	12: 4,775,487	M108K	probably damaging	Het
Pibf1	C	T	14: 99,179,367	Q459*	probably null	Het
Pkd1l1	C	T	11: 8,947,241	C556Y	probably damaging	Het
Plin1	A	G	7: 79,729,851	F84L	possibly damaging	Het
Rasa3	A	G	8: 13,577,801		probably null	Het
Sdc1	G	A	12: 8,790,663	V143I	probably benign	Het
Skor2	C	A	18: 76,859,678	A365E	unknown	Het
Slc16a7	A	G	10: 125,328,333		probably null	Het
Slc25a31	T	A	3: 40,709,143	V51E	probably damaging	Het
Slc6a6	C	A	6: 91,726,106	F153L	probably damaging	Het
Snx7	T	A	3: 117,837,245	K238M	probably damaging	Het
Soga3	T	C	10: 29,196,898	S729P	probably damaging	Het
Spata3	C	T	1: 86,024,353	R110C	unknown	Het
Sphkap	T	G	1: 83,263,582	Q1587P	probably damaging	Het
Tcte1	T	C	17: 45,539,692	I298T	possibly damaging	Het
Tmem247	A	G	17: 86,922,367	Y120C		Het
Togaram2	C	G	17: 71,716,494	L802V	probably benign	Het
Trim32	T	C	4: 65,613,962	V252A	probably benign	Het
Ttc37	T	C	13: 76,130,327		probably null	Het
Vat1	T	C	11: 101,460,203	K404R	probably benign	Het
Xirp2	C	A	2: 67,512,035	T1540K	probably benign	Het
Zc2hc1c	C	T	12: 85,296,612	H508Y	probably damaging	Het
Zfp407	A	T	18: 84,561,185	M601K	probably damaging	Het
Zfp951	A	T	5: 104,815,303	Y132*	probably null	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGTGTGCAAATTCATGTGAGTC -3'
(R):5'- TCAGGCCTTGGAAAAGAGGC -3'

Sequencing Primer
(F):5'- GAATGAGCTGATTTAAGTCTACGAG -3'
(R):5'- CCTTGGAAAAGAGGCTTCCC -3'

Posted On

2020-06-30