Incidental Mutation 'R8126:Cstl1'
List |< first << previous [record 12 of 43] next >> last >|
ID631748
Institutional Source Beutler Lab
Gene Symbol Cstl1
Ensembl Gene ENSMUSG00000055177
Gene Namecystatin-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location148750358-148755433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148754671 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 98 (E98G)
Ref Sequence ENSEMBL: ENSMUSP00000105581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109952] [ENSMUST00000109954] [ENSMUST00000109955]
Predicted Effect probably benign
Transcript: ENSMUST00000109952
AA Change: E98G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105578
Gene: ENSMUSG00000055177
AA Change: E98G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109954
AA Change: E46G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105580
Gene: ENSMUSG00000055177
AA Change: E46G

DomainStartEndE-ValueType
Pfam:Cystatin 13 74 5.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109955
AA Change: E98G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105581
Gene: ENSMUSG00000055177
AA Change: E98G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located at the telomeric end of the cystatin locus and encodes a type 2 cystatin-like protein. The specific function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Cstl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Cstl1 UTSW 2 148755325 missense probably damaging 1.00
R0477:Cstl1 UTSW 2 148750988 missense probably benign 0.06
R1706:Cstl1 UTSW 2 148751159 splice site probably null
R2471:Cstl1 UTSW 2 148751121 nonsense probably null
R2938:Cstl1 UTSW 2 148751057 missense possibly damaging 0.59
R4005:Cstl1 UTSW 2 148755270 missense probably damaging 0.99
R5071:Cstl1 UTSW 2 148750927 start codon destroyed probably benign 0.01
R7019:Cstl1 UTSW 2 148755303 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGACCAGAGATCTCAGTTGCC -3'
(R):5'- CAGATGCACCAAGAAGTGTG -3'

Sequencing Primer
(F):5'- TTGCCAGAATCACTCAATGGG -3'
(R):5'- CACCAAGAAGTGTGAGCTTGCC -3'
Posted On2020-06-30