Incidental Mutation 'R8126:Vmn1r22'
List |< first << previous [record 39 of 43] next >> last >|
ID631757
Institutional Source Beutler Lab
Gene Symbol Vmn1r22
Ensembl Gene ENSMUSG00000115091
Gene Namevomeronasal 1 receptor 22
SynonymsV1rc23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location57898126-57908028 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57900684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 103 (V103F)
Ref Sequence ENSEMBL: ENSMUSP00000153802 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000227342
Predicted Effect possibly damaging
Transcript: ENSMUST00000227650
AA Change: V103F

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228076
AA Change: V103F

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228257
AA Change: V103F

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228322
AA Change: V103F

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000228905
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Vmn1r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Vmn1r22 UTSW 6 57900528 missense probably benign 0.06
R0415:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
R1132:Vmn1r22 UTSW 6 57900841 missense probably benign 0.43
R1609:Vmn1r22 UTSW 6 57900748 nonsense probably null
R1666:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1668:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1708:Vmn1r22 UTSW 6 57900496 missense possibly damaging 0.46
R1796:Vmn1r22 UTSW 6 57900149 missense probably damaging 1.00
R2359:Vmn1r22 UTSW 6 57900989 start codon destroyed probably null 1.00
R4600:Vmn1r22 UTSW 6 57900875 missense probably damaging 1.00
R5302:Vmn1r22 UTSW 6 57900975 missense possibly damaging 0.87
R5560:Vmn1r22 UTSW 6 57900738 missense probably damaging 1.00
R6026:Vmn1r22 UTSW 6 57900405 missense probably benign 0.00
R6066:Vmn1r22 UTSW 6 57900879 missense probably benign 0.01
R6343:Vmn1r22 UTSW 6 57900578 missense possibly damaging 0.65
R6639:Vmn1r22 UTSW 6 57900714 missense probably benign 0.01
R7106:Vmn1r22 UTSW 6 57900311 missense probably damaging 1.00
R7683:Vmn1r22 UTSW 6 57900419 missense probably damaging 1.00
S24628:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTGTTCATGGGAAAGTGTGAAC -3'
(R):5'- TAAGCCCATGGACCTGATCTTATG -3'

Sequencing Primer
(F):5'- AACAGGTTTTAGTGATTCTCATCTGG -3'
(R):5'- GGACCTGATCTTATGTCAATTTTCC -3'
Posted On2020-06-30