Incidental Mutation 'R8126:Snrpa'
List |< first << previous [record 33 of 43] next >> last >|
ID631758
Institutional Source Beutler Lab
Gene Symbol Snrpa
Ensembl Gene ENSMUSG00000061479
Gene Namesmall nuclear ribonucleoprotein polypeptide A
SynonymsRnu1a1, C430021M15Rik, U1 snRNP, U1A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8126 (G1)
Quality Score201.009
Status Validated
Chromosome7
Chromosomal Location27187005-27196271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27192948 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 62 (F62L)
Ref Sequence ENSEMBL: ENSMUSP00000079228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080356] [ENSMUST00000108379] [ENSMUST00000122202] [ENSMUST00000126211] [ENSMUST00000141378] [ENSMUST00000163311] [ENSMUST00000179391]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080356
AA Change: F62L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079228
Gene: ENSMUSG00000061479
AA Change: F62L

DomainStartEndE-ValueType
RRM 17 91 2.3e-14 SMART
low complexity region 109 120 N/A INTRINSIC
low complexity region 125 156 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
RRM 214 283 6.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108379
SMART Domains Protein: ENSMUSP00000104016
Gene: ENSMUSG00000078786

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122202
AA Change: F62L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113678
Gene: ENSMUSG00000061479
AA Change: F62L

DomainStartEndE-ValueType
RRM 17 91 2.3e-14 SMART
low complexity region 109 120 N/A INTRINSIC
low complexity region 125 156 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
RRM 214 283 6.31e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126211
AA Change: F62L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115335
Gene: ENSMUSG00000061479
AA Change: F62L

DomainStartEndE-ValueType
RRM 17 91 2.3e-14 SMART
low complexity region 109 120 N/A INTRINSIC
low complexity region 125 156 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
Pfam:RRM_1 215 247 3.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141378
Predicted Effect probably benign
Transcript: ENSMUST00000155931
SMART Domains Protein: ENSMUSP00000123290
Gene: ENSMUSG00000078786

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163311
AA Change: F62L

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131897
Gene: ENSMUSG00000061479
AA Change: F62L

DomainStartEndE-ValueType
RRM 17 91 2.3e-14 SMART
low complexity region 109 120 N/A INTRINSIC
low complexity region 125 156 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
RRM 214 283 6.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179391
SMART Domains Protein: ENSMUSP00000137189
Gene: ENSMUSG00000078786

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Snrpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Snrpa APN 7 27192970 missense probably benign 0.18
IGL01623:Snrpa APN 7 27192970 missense probably benign 0.18
IGL02562:Snrpa APN 7 27191698 missense probably damaging 0.98
IGL03077:Snrpa APN 7 27191761 missense probably benign 0.00
lowly UTSW 7 27192946 missense possibly damaging 0.59
R1454:Snrpa UTSW 7 27192937 missense probably benign 0.34
R1779:Snrpa UTSW 7 27191749 missense probably benign 0.02
R4238:Snrpa UTSW 7 27192868 critical splice donor site probably null
R4601:Snrpa UTSW 7 27195533 start codon destroyed probably null 0.04
R6986:Snrpa UTSW 7 27192964 missense probably damaging 0.98
R7114:Snrpa UTSW 7 27191749 missense probably benign
R7529:Snrpa UTSW 7 27189453 missense probably benign 0.03
R7756:Snrpa UTSW 7 27192946 missense possibly damaging 0.59
R7758:Snrpa UTSW 7 27192946 missense possibly damaging 0.59
R8380:Snrpa UTSW 7 27187288 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CCCCGTATAAGGAACACAGG -3'
(R):5'- CTGAGGATAGTGCAAGTACCAG -3'

Sequencing Primer
(F):5'- TAGCATCCTTAGGGACCAGCATAG -3'
(R):5'- TGCAAGTACCAGGACACAGTGTC -3'
Posted On2020-06-30