Incidental Mutation 'R8126:Nfkbid'
ID631759
Institutional Source Beutler Lab
Gene Symbol Nfkbid
Ensembl Gene ENSMUSG00000036931
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, delta
SynonymsIkappaBNS
MMRRC Submission
Accession Numbers

Genbank: NM_172142; MGI: 3041243

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8126 (G1)
Quality Score222.009
Status Validated
Chromosome7
Chromosomal Location30421732-30428746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30424374 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 120 (S120T)
Ref Sequence ENSEMBL: ENSMUSP00000103811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046177] [ENSMUST00000075062] [ENSMUST00000108175] [ENSMUST00000108176] [ENSMUST00000208740]
Predicted Effect probably benign
Transcript: ENSMUST00000046177
SMART Domains Protein: ENSMUSP00000042317
Gene: ENSMUSG00000036931

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075062
SMART Domains Protein: ENSMUSP00000074573
Gene: ENSMUSG00000064109

DomainStartEndE-ValueType
Pfam:DAP10 1 79 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108175
SMART Domains Protein: ENSMUSP00000103810
Gene: ENSMUSG00000036931

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108176
AA Change: S120T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103811
Gene: ENSMUSG00000036931
AA Change: S120T

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208740
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele produce higher levels of IL-6 following stimulation and are more susceptible to chemically induced endotoxin shock and colitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Nfkbid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Nfkbid APN 7 30425264 nonsense probably null
IGL02809:Nfkbid APN 7 30425235 missense possibly damaging 0.60
bumble UTSW 7 30425411 critical splice donor site probably benign
R1515:Nfkbid UTSW 7 30425356 missense probably benign 0.00
R5550:Nfkbid UTSW 7 30426001 missense probably damaging 0.99
R6190:Nfkbid UTSW 7 30425737 missense probably damaging 1.00
R6668:Nfkbid UTSW 7 30424441 missense probably benign 0.00
R6994:Nfkbid UTSW 7 30425767 missense probably benign
R7137:Nfkbid UTSW 7 30426256 missense possibly damaging 0.60
R7788:Nfkbid UTSW 7 30427178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAACAGGCTGGTTCTGACC -3'
(R):5'- CATGGAGACTGAACCCCATG -3'

Sequencing Primer
(F):5'- GACCACCCTCTCTGTTTCAGG -3'
(R):5'- GAACTCATTCTGTAGCCCAGGTAG -3'
Posted On2020-06-30