Incidental Mutation 'R8126:Aplp1'
ID631760
Institutional Source Beutler Lab
Gene Symbol Aplp1
Ensembl Gene ENSMUSG00000006651
Gene Nameamyloid beta (A4) precursor-like protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30434982-30445535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30441739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 299 (D299V)
Ref Sequence ENSEMBL: ENSMUSP00000006828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006828]
Predicted Effect probably damaging
Transcript: ENSMUST00000006828
AA Change: D299V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006828
Gene: ENSMUSG00000006651
AA Change: D299V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
A4_EXTRA 46 211 1.72e-114 SMART
low complexity region 234 247 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
Pfam:APP_E2 289 471 9.3e-72 PFAM
Pfam:APP_amyloid 600 651 9.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved amyloid precursor protein gene family. The encoded protein is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. The encoded protein may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show a 10% decrease in body weight at 9 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Aplp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Aplp1 APN 7 30444418 missense probably damaging 0.97
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0034:Aplp1 UTSW 7 30444442 missense probably damaging 1.00
R1480:Aplp1 UTSW 7 30436023 missense probably benign 0.01
R1538:Aplp1 UTSW 7 30436027 missense probably benign
R2177:Aplp1 UTSW 7 30442521 nonsense probably null
R3017:Aplp1 UTSW 7 30435971 critical splice donor site probably null
R5143:Aplp1 UTSW 7 30441123 missense probably damaging 1.00
R5465:Aplp1 UTSW 7 30436852 missense probably benign
R5482:Aplp1 UTSW 7 30440175 missense probably damaging 1.00
R5530:Aplp1 UTSW 7 30436829 missense possibly damaging 0.70
R6112:Aplp1 UTSW 7 30435477 missense probably damaging 1.00
R6721:Aplp1 UTSW 7 30440295 missense probably null 1.00
R6931:Aplp1 UTSW 7 30443200 missense probably damaging 1.00
R7314:Aplp1 UTSW 7 30435989 missense probably damaging 0.98
R7707:Aplp1 UTSW 7 30443098 missense probably damaging 1.00
R7980:Aplp1 UTSW 7 30435567 missense probably benign 0.44
R8005:Aplp1 UTSW 7 30436045 critical splice acceptor site probably null
Z1177:Aplp1 UTSW 7 30438189 missense probably benign 0.44
Z1177:Aplp1 UTSW 7 30438279 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTAATCCATTGCCTGAGTGTG -3'
(R):5'- GCAAACACTGGTTAGGCCTG -3'

Sequencing Primer
(F):5'- CTCAGGTCGAAGGATGCTTG -3'
(R):5'- TTAGGCCTGGGACCATGATGC -3'
Posted On2020-06-30