Incidental Mutation 'R8126:Ddx49'
ID631764
Institutional Source Beutler Lab
Gene Symbol Ddx49
Ensembl Gene ENSMUSG00000057788
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 49
SynonymsR27090_2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70292866-70302489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70295596 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 303 (I303N)
Ref Sequence ENSEMBL: ENSMUSP00000008004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000110124] [ENSMUST00000140212]
Predicted Effect probably benign
Transcript: ENSMUST00000003669
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000008004
AA Change: I303N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788
AA Change: I303N

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110124
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135368
Predicted Effect probably benign
Transcript: ENSMUST00000140212
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Ddx49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ddx49 APN 8 70294756 nonsense probably null
IGL02630:Ddx49 APN 8 70301018 missense probably damaging 1.00
R0306:Ddx49 UTSW 8 70294672 unclassified probably benign
R0394:Ddx49 UTSW 8 70296925 missense probably damaging 0.97
R0421:Ddx49 UTSW 8 70295632 missense probably damaging 1.00
R0524:Ddx49 UTSW 8 70296924 missense probably damaging 0.98
R0764:Ddx49 UTSW 8 70297257 missense probably benign 0.01
R1051:Ddx49 UTSW 8 70294685 critical splice donor site probably null
R1852:Ddx49 UTSW 8 70300983 missense probably damaging 1.00
R2008:Ddx49 UTSW 8 70295444 missense probably damaging 1.00
R6216:Ddx49 UTSW 8 70297284 missense probably damaging 1.00
R7085:Ddx49 UTSW 8 70302483 unclassified probably benign
R7102:Ddx49 UTSW 8 70301076 missense probably damaging 1.00
R7648:Ddx49 UTSW 8 70297955 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGATGTAGATCTTGGGAAGCCC -3'
(R):5'- AACACTGTGATACCGCTCCC -3'

Sequencing Primer
(F):5'- GAAGCCCAGGGGTGTTG -3'
(R):5'- GATACCGCTCCCCTCCTCATG -3'
Posted On2020-06-30