Incidental Mutation 'R8126:Csnk2a2'
ID631766
Institutional Source Beutler Lab
Gene Symbol Csnk2a2
Ensembl Gene ENSMUSG00000046707
Gene Namecasein kinase 2, alpha prime polypeptide
SynonymsCK2, 1110035J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location95446096-95490039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95455947 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 296 (P296L)
Ref Sequence ENSEMBL: ENSMUSP00000055919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056919] [ENSMUST00000212214] [ENSMUST00000212952]
Predicted Effect
SMART Domains Protein: ENSMUSP00000055919
Gene: ENSMUSG00000046707
AA Change: P296L

DomainStartEndE-ValueType
S_TKc 40 325 1.85e-77 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212441
Predicted Effect
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000212952
AA Change: P201L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Males homozygotes for a targeted null mutation of the minor catalytic subunit exhibit infertility with oligospermia and abnormally shaped spermatid nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Csnk2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Csnk2a2 APN 8 95477231 missense possibly damaging 0.87
R1452:Csnk2a2 UTSW 8 95457375 splice site probably benign
R1717:Csnk2a2 UTSW 8 95455808 splice site probably null
R4260:Csnk2a2 UTSW 8 95457399 missense probably benign 0.01
R6062:Csnk2a2 UTSW 8 95457469 missense possibly damaging 0.93
R7169:Csnk2a2 UTSW 8 95488378 missense
R8124:Csnk2a2 UTSW 8 95455947 missense
R8125:Csnk2a2 UTSW 8 95455947 missense
R8253:Csnk2a2 UTSW 8 95488377 missense
Predicted Primers PCR Primer
(F):5'- TGTCTTTTAATAACTCACAGGGCTG -3'
(R):5'- ACAGTGCACCGTTCTAAGGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CACCGTTCTAAGGGGTCCTTG -3'
Posted On2020-06-30