Incidental Mutation 'R8126:Npat'
List |< first << previous [record 27 of 43] next >> last >|
ID631767
Institutional Source Beutler Lab
Gene Symbol Npat
Ensembl Gene ENSMUSG00000033054
Gene Namenuclear protein in the AT region
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location53537047-53574342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53552334 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 139 (V139A)
Ref Sequence ENSEMBL: ENSMUSP00000048709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035850]
Predicted Effect probably benign
Transcript: ENSMUST00000035850
AA Change: V139A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: V139A

DomainStartEndE-ValueType
LisH 3 35 3.09e-3 SMART
low complexity region 585 592 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:NPAT_C 754 1420 4.7e-299 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Npat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Npat APN 9 53566800 missense possibly damaging 0.82
IGL00503:Npat APN 9 53572649 utr 3 prime probably benign
IGL00694:Npat APN 9 53563517 missense probably benign 0.00
IGL00731:Npat APN 9 53562086 missense probably damaging 0.99
IGL00907:Npat APN 9 53563290 missense possibly damaging 0.64
IGL00949:Npat APN 9 53563362 missense probably benign 0.17
IGL01403:Npat APN 9 53555129 missense probably benign 0.02
IGL01626:Npat APN 9 53556571 missense possibly damaging 0.92
IGL01936:Npat APN 9 53558226 splice site probably benign
IGL02142:Npat APN 9 53569907 missense probably benign
IGL02215:Npat APN 9 53559117 missense probably benign 0.00
IGL02250:Npat APN 9 53548951 nonsense probably null
IGL02624:Npat APN 9 53566810 missense probably damaging 1.00
IGL02928:Npat APN 9 53566838 splice site probably benign
IGL02931:Npat APN 9 53571041 nonsense probably null
IGL03128:Npat APN 9 53550033 splice site probably benign
IGL03238:Npat APN 9 53570426 missense probably damaging 0.98
R0606:Npat UTSW 9 53556481 critical splice donor site probably null
R0688:Npat UTSW 9 53570222 missense probably benign 0.18
R0839:Npat UTSW 9 53545180 missense probably damaging 0.99
R0947:Npat UTSW 9 53570324 missense probably benign 0.08
R1070:Npat UTSW 9 53572592 missense probably damaging 1.00
R1480:Npat UTSW 9 53563066 frame shift probably null
R1599:Npat UTSW 9 53562404 missense possibly damaging 0.62
R1644:Npat UTSW 9 53570172 missense probably damaging 1.00
R1646:Npat UTSW 9 53555134 missense probably benign 0.32
R1699:Npat UTSW 9 53562660 missense probably benign
R1765:Npat UTSW 9 53570222 missense probably benign 0.00
R1793:Npat UTSW 9 53552289 missense probably damaging 1.00
R1866:Npat UTSW 9 53563116 missense probably damaging 1.00
R1898:Npat UTSW 9 53563637 missense probably damaging 1.00
R2018:Npat UTSW 9 53562491 missense probably benign 0.34
R2019:Npat UTSW 9 53562491 missense probably benign 0.34
R2213:Npat UTSW 9 53552381 missense probably benign 0.00
R2432:Npat UTSW 9 53558135 missense probably damaging 1.00
R3816:Npat UTSW 9 53569916 missense probably damaging 0.99
R4764:Npat UTSW 9 53572620 missense probably damaging 1.00
R4889:Npat UTSW 9 53562207 missense probably benign 0.00
R4895:Npat UTSW 9 53570489 missense probably damaging 1.00
R4923:Npat UTSW 9 53571030 missense probably damaging 1.00
R5377:Npat UTSW 9 53550036 critical splice acceptor site probably null
R5397:Npat UTSW 9 53570474 missense probably damaging 1.00
R5504:Npat UTSW 9 53570264 missense probably benign 0.01
R5509:Npat UTSW 9 53570242 missense probably benign 0.00
R5563:Npat UTSW 9 53563127 missense probably damaging 0.97
R5677:Npat UTSW 9 53555100 missense probably benign 0.00
R5868:Npat UTSW 9 53570124 missense probably damaging 0.96
R5927:Npat UTSW 9 53562221 nonsense probably null
R6009:Npat UTSW 9 53563449 missense probably damaging 0.99
R6247:Npat UTSW 9 53545238 missense probably damaging 1.00
R6434:Npat UTSW 9 53563439 missense possibly damaging 0.81
R6784:Npat UTSW 9 53558158 missense probably damaging 1.00
R6799:Npat UTSW 9 53551630 missense probably benign 0.21
R6878:Npat UTSW 9 53556599 missense probably benign
R7027:Npat UTSW 9 53569916 missense possibly damaging 0.90
R7383:Npat UTSW 9 53562778 missense probably benign
R7404:Npat UTSW 9 53554933 splice site probably null
R7408:Npat UTSW 9 53569916 missense probably damaging 0.99
R7444:Npat UTSW 9 53548910 missense probably damaging 0.97
R7755:Npat UTSW 9 53559170 missense possibly damaging 0.92
R7992:Npat UTSW 9 53562867 missense probably benign 0.00
R8108:Npat UTSW 9 53571129 missense probably benign 0.00
R8213:Npat UTSW 9 53570570 nonsense probably null
R8354:Npat UTSW 9 53566951 missense possibly damaging 0.93
R8429:Npat UTSW 9 53570609 nonsense probably null
R8454:Npat UTSW 9 53566951 missense possibly damaging 0.93
Z1177:Npat UTSW 9 53566828 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCATATAGGCCATGCAACATAG -3'
(R):5'- TCTTGTGGCTGAACAATTGTC -3'

Sequencing Primer
(F):5'- CCATGCAACATAGTGTCTTGGTCAG -3'
(R):5'- ATCTCGCCCTTGGGCCATG -3'
Posted On2020-06-30