Incidental Mutation 'R8126:Nktr'
ID631769
Institutional Source Beutler Lab
Gene Symbol Nktr
Ensembl Gene ENSMUSG00000032525
Gene Namenatural killer tumor recognition sequence
Synonyms5330401F18Rik, D9Wsu172e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R8126 (G1)
Quality Score194.009
Status Validated
Chromosome9
Chromosomal Location121719169-121756843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121746448 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 341 (Y341H)
Ref Sequence ENSEMBL: ENSMUSP00000035112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035112] [ENSMUST00000182179] [ENSMUST00000182225] [ENSMUST00000182503] [ENSMUST00000182763] [ENSMUST00000183070]
Predicted Effect probably damaging
Transcript: ENSMUST00000035112
AA Change: Y341H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035112
Gene: ENSMUSG00000032525
AA Change: Y341H

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 1.7e-48 PFAM
low complexity region 195 229 N/A INTRINSIC
low complexity region 277 294 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
low complexity region 427 459 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
low complexity region 509 565 N/A INTRINSIC
low complexity region 677 726 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 921 929 N/A INTRINSIC
low complexity region 948 958 N/A INTRINSIC
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1189 1200 N/A INTRINSIC
low complexity region 1229 1236 N/A INTRINSIC
low complexity region 1316 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182179
SMART Domains Protein: ENSMUSP00000138437
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000182225
AA Change: Y316H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138168
Gene: ENSMUSG00000032525
AA Change: Y316H

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 2.1e-47 PFAM
low complexity region 184 215 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
low complexity region 402 434 N/A INTRINSIC
low complexity region 452 478 N/A INTRINSIC
low complexity region 484 540 N/A INTRINSIC
low complexity region 652 701 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
low complexity region 875 889 N/A INTRINSIC
low complexity region 896 904 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182503
SMART Domains Protein: ENSMUSP00000138463
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
low complexity region 10 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182763
SMART Domains Protein: ENSMUSP00000138272
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 68 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183070
SMART Domains Protein: ENSMUSP00000138611
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Nktr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Nktr APN 9 121731564 missense possibly damaging 0.94
IGL01402:Nktr APN 9 121741152 splice site probably null
IGL01404:Nktr APN 9 121741152 splice site probably null
IGL02945:Nktr APN 9 121728631 missense probably damaging 1.00
IGL03334:Nktr APN 9 121748176 missense probably benign 0.18
IGL03134:Nktr UTSW 9 121746466 missense probably damaging 1.00
PIT4131001:Nktr UTSW 9 121741621 missense probably damaging 1.00
R0010:Nktr UTSW 9 121741166 splice site probably benign
R0158:Nktr UTSW 9 121750691 unclassified probably benign
R0399:Nktr UTSW 9 121731484 missense probably damaging 0.98
R0503:Nktr UTSW 9 121750740 unclassified probably benign
R0585:Nktr UTSW 9 121754280 utr 3 prime probably benign
R0606:Nktr UTSW 9 121749290 unclassified probably benign
R1248:Nktr UTSW 9 121727370 missense probably damaging 1.00
R1899:Nktr UTSW 9 121748866 unclassified probably benign
R1912:Nktr UTSW 9 121750240 unclassified probably benign
R2049:Nktr UTSW 9 121741694 missense probably damaging 1.00
R2279:Nktr UTSW 9 121731537 missense possibly damaging 0.93
R2912:Nktr UTSW 9 121749604 unclassified probably benign
R2913:Nktr UTSW 9 121749604 unclassified probably benign
R2914:Nktr UTSW 9 121749604 unclassified probably benign
R3939:Nktr UTSW 9 121749069 unclassified probably benign
R4080:Nktr UTSW 9 121741126 missense probably damaging 1.00
R4471:Nktr UTSW 9 121748896 unclassified probably benign
R4472:Nktr UTSW 9 121748896 unclassified probably benign
R4506:Nktr UTSW 9 121748883 unclassified probably benign
R4556:Nktr UTSW 9 121741123 missense probably damaging 0.98
R4736:Nktr UTSW 9 121749739 unclassified probably benign
R4749:Nktr UTSW 9 121741693 missense probably damaging 1.00
R4943:Nktr UTSW 9 121719954 intron probably benign
R5084:Nktr UTSW 9 121748110 missense possibly damaging 0.86
R5250:Nktr UTSW 9 121749792 unclassified probably benign
R5288:Nktr UTSW 9 121748593 missense probably benign 0.23
R5324:Nktr UTSW 9 121727346 missense probably damaging 1.00
R5330:Nktr UTSW 9 121752768 intron probably benign
R5331:Nktr UTSW 9 121752768 intron probably benign
R5502:Nktr UTSW 9 121748606 unclassified probably benign
R5587:Nktr UTSW 9 121748489 unclassified probably benign
R5664:Nktr UTSW 9 121749417 nonsense probably null
R6005:Nktr UTSW 9 121748394 unclassified probably benign
R6057:Nktr UTSW 9 121748389 unclassified probably benign
R6083:Nktr UTSW 9 121750136 unclassified probably benign
R6274:Nktr UTSW 9 121731565 missense probably damaging 1.00
R6445:Nktr UTSW 9 121748414 unclassified probably benign
R6467:Nktr UTSW 9 121731519 missense probably damaging 1.00
R6911:Nktr UTSW 9 121754326 nonsense probably null
R6960:Nktr UTSW 9 121742692 missense probably damaging 0.99
R7226:Nktr UTSW 9 121746533 missense probably damaging 0.99
R7324:Nktr UTSW 9 121727361 missense probably damaging 1.00
R7324:Nktr UTSW 9 121748291 missense possibly damaging 0.66
R7451:Nktr UTSW 9 121729656 missense probably damaging 0.99
R7464:Nktr UTSW 9 121750327 missense unknown
R7537:Nktr UTSW 9 121749279 missense unknown
R8163:Nktr UTSW 9 121750863 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGATTTCAGATGAATGTCTTGCC -3'
(R):5'- CCTATTAGAGACTGCCAGGC -3'

Sequencing Primer
(F):5'- AGATGAATGTCTTGCCTCTTTTGC -3'
(R):5'- AGTGACTCTCCAGCACTGAG -3'
Posted On2020-06-30