Incidental Mutation 'R8126:Rnf146'
List |< first << previous [record 32 of 43] next >> last >|
ID631770
Institutional Source Beutler Lab
Gene Symbol Rnf146
Ensembl Gene ENSMUSG00000038876
Gene Namering finger protein 146
Synonyms2610509H23Rik, Iduna
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location29344176-29362442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29347376 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 171 (I171M)
Ref Sequence ENSEMBL: ENSMUSP00000124288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020034] [ENSMUST00000037548] [ENSMUST00000160144] [ENSMUST00000160372] [ENSMUST00000160399] [ENSMUST00000161508] [ENSMUST00000161605] [ENSMUST00000162335] [ENSMUST00000214896]
Predicted Effect probably benign
Transcript: ENSMUST00000020034
SMART Domains Protein: ENSMUSP00000020034
Gene: ENSMUSG00000019883

DomainStartEndE-ValueType
Pfam:ECH_1 74 307 4.8e-39 PFAM
Pfam:ECH_2 79 321 4.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000037548
AA Change: I171M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037224
Gene: ENSMUSG00000038876
AA Change: I171M

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160144
AA Change: I171M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124288
Gene: ENSMUSG00000038876
AA Change: I171M

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160372
AA Change: I171M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124215
Gene: ENSMUSG00000038876
AA Change: I171M

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160399
SMART Domains Protein: ENSMUSP00000125553
Gene: ENSMUSG00000019883

DomainStartEndE-ValueType
Pfam:ECH 49 293 1.6e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161508
AA Change: I171M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124814
Gene: ENSMUSG00000038876
AA Change: I171M

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161605
SMART Domains Protein: ENSMUSP00000125048
Gene: ENSMUSG00000019883

DomainStartEndE-ValueType
Pfam:ECH 49 165 4.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162335
AA Change: I171M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124772
Gene: ENSMUSG00000038876
AA Change: I171M

DomainStartEndE-ValueType
RING 38 75 1.79e-6 SMART
WWE 102 177 4.93e-35 SMART
low complexity region 197 212 N/A INTRINSIC
low complexity region 282 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214896
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in immune cells exhibit osteopenia with enhanced osteoclastogenesis. Mice homozygous for a conditional allele activated in osteoblast exhibit ostepenia with impaired osteoblast numbers, increased adipogenesis and impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Rnf146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Rnf146 APN 10 29347860 missense probably damaging 0.99
IGL02151:Rnf146 APN 10 29347353 missense probably damaging 1.00
R1024:Rnf146 UTSW 10 29347096 nonsense probably null
R1757:Rnf146 UTSW 10 29347479 missense probably damaging 0.99
R1844:Rnf146 UTSW 10 29347724 missense probably damaging 1.00
R1923:Rnf146 UTSW 10 29347719 missense probably damaging 1.00
R3404:Rnf146 UTSW 10 29347428 missense possibly damaging 0.91
R4060:Rnf146 UTSW 10 29347367 missense probably damaging 1.00
R5689:Rnf146 UTSW 10 29347804 missense probably benign
R6742:Rnf146 UTSW 10 29347532 missense probably damaging 1.00
R7459:Rnf146 UTSW 10 29347644 missense probably benign 0.08
X0067:Rnf146 UTSW 10 29347788 missense probably benign 0.09
Z1088:Rnf146 UTSW 10 29347572 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTACAGGGCTGGTTAACTGAC -3'
(R):5'- CTTAAGGCTGCAAGCAGAGG -3'

Sequencing Primer
(F):5'- AACAGAAGCTCCAGTCTG -3'
(R):5'- AAATGGTGAATATGCGTGGTATTATG -3'
Posted On2020-06-30