Incidental Mutation 'R8126:Hsp90b1'
ID631772
Institutional Source Beutler Lab
Gene Symbol Hsp90b1
Ensembl Gene ENSMUSG00000020048
Gene Nameheat shock protein 90, beta (Grp94), member 1
SynonymsERp99, tumor rejection antigen (gp96) 1, Targ2, endoplasmin, Tra-1, Tra1, gp96, GRP94, 90 kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location86690209-86705509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86694382 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 538 (I538V)
Ref Sequence ENSEMBL: ENSMUSP00000020238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020238] [ENSMUST00000129413]
Predicted Effect probably damaging
Transcript: ENSMUST00000020238
AA Change: I538V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020238
Gene: ENSMUSG00000020048
AA Change: I538V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
HATPase_c 96 255 4.96e-9 SMART
Pfam:HSP90 257 781 2.5e-233 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129413
AA Change: I214V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122710
Gene: ENSMUSG00000020048
AA Change: I214V

DomainStartEndE-ValueType
coiled coil region 9 35 N/A INTRINSIC
Pfam:HSP90 39 373 3.8e-170 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with failure of primitive streak formation, absence of the chorion and amnion, and failure of mesoderm formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Hsp90b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Hsp90b1 APN 10 86704370 missense probably benign 0.40
IGL01671:Hsp90b1 APN 10 86704325 missense probably benign 0.07
IGL01673:Hsp90b1 APN 10 86693432 missense probably damaging 0.99
IGL02097:Hsp90b1 APN 10 86691684 unclassified probably benign
IGL02124:Hsp90b1 APN 10 86705358 unclassified probably benign
IGL02257:Hsp90b1 APN 10 86698589 missense probably damaging 1.00
IGL02339:Hsp90b1 APN 10 86701814 missense probably damaging 1.00
IGL02342:Hsp90b1 APN 10 86695739 critical splice acceptor site probably null
R0329:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R0330:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R0735:Hsp90b1 UTSW 10 86695748 splice site probably benign
R1531:Hsp90b1 UTSW 10 86696795 missense probably benign 0.02
R1540:Hsp90b1 UTSW 10 86694042 missense probably damaging 1.00
R1711:Hsp90b1 UTSW 10 86694525 missense probably damaging 1.00
R1797:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R2128:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2129:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2903:Hsp90b1 UTSW 10 86703485 missense probably damaging 1.00
R4735:Hsp90b1 UTSW 10 86693955 missense probably damaging 1.00
R4749:Hsp90b1 UTSW 10 86701808 missense probably damaging 1.00
R5011:Hsp90b1 UTSW 10 86696753 missense probably benign 0.37
R5650:Hsp90b1 UTSW 10 86693503 missense probably damaging 1.00
R5950:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R6731:Hsp90b1 UTSW 10 86701905 missense probably benign 0.01
R6835:Hsp90b1 UTSW 10 86694085 missense probably damaging 1.00
R7038:Hsp90b1 UTSW 10 86695866 missense probably damaging 0.99
R7250:Hsp90b1 UTSW 10 86691708 missense unknown
R7343:Hsp90b1 UTSW 10 86692183 missense probably damaging 1.00
R8027:Hsp90b1 UTSW 10 86696730 missense probably damaging 0.97
R8336:Hsp90b1 UTSW 10 86691104 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCAAGTTCTGCCTTGGCAC -3'
(R):5'- TGGACATGATCAAGAAGATTGCTG -3'

Sequencing Primer
(F):5'- AAGTTCTGCCTTGGCACATTAG -3'
(R):5'- TTGCTGATGAGAAGTATAACGACAC -3'
Posted On2020-06-30