Incidental Mutation 'R8126:Ncoa1'
ID631773
Institutional Source Beutler Lab
Gene Symbol Ncoa1
Ensembl Gene ENSMUSG00000020647
Gene Namenuclear receptor coactivator 1
SynonymsbHLHe74, SRC-a/NCoA-1, KAT13A, SRC-1, SRC1, steroid receptor coactivator-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4247362-4477182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4290951 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 827 (L827Q)
Ref Sequence ENSEMBL: ENSMUSP00000151358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085814] [ENSMUST00000217674] [ENSMUST00000217794] [ENSMUST00000219275] [ENSMUST00000220434]
Predicted Effect probably damaging
Transcript: ENSMUST00000085814
AA Change: L827Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082971
Gene: ENSMUSG00000020647
AA Change: L827Q

DomainStartEndE-ValueType
HLH 29 86 1.73e-9 SMART
PAS 111 178 1.32e-10 SMART
Pfam:PAS_11 259 370 8e-37 PFAM
low complexity region 419 441 N/A INTRINSIC
Pfam:NCOA_u2 468 591 1.3e-29 PFAM
Pfam:SRC-1 632 712 3.5e-26 PFAM
low complexity region 724 736 N/A INTRINSIC
PDB:3RVF|B 747 767 1e-6 PDB
low complexity region 777 785 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
Pfam:Nuc_rec_co-act 930 977 2.3e-23 PFAM
low complexity region 1059 1080 N/A INTRINSIC
low complexity region 1125 1137 N/A INTRINSIC
DUF1518 1155 1211 7.47e-16 SMART
DUF1518 1218 1274 1.14e-11 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217674
AA Change: L716Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217794
AA Change: L827Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219275
Predicted Effect probably damaging
Transcript: ENSMUST00000220434
AA Change: L827Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show osteopenia, increased serum sex hormone levels, altered bone remodeling and skeletal responses to sex hormones, and obesity. Homozygotes for another null allele show thyroid and steroid hormone resistance, delayed Purkinje cell development, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Ncoa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ncoa1 APN 12 4278218 missense probably benign
IGL01335:Ncoa1 APN 12 4297520 missense probably benign 0.31
IGL02111:Ncoa1 APN 12 4274944 start codon destroyed probably null
IGL02863:Ncoa1 APN 12 4297513 missense probably benign 0.00
IGL02967:Ncoa1 APN 12 4295294 missense probably damaging 1.00
IGL03007:Ncoa1 APN 12 4339114 missense possibly damaging 0.92
IGL03031:Ncoa1 APN 12 4274818 missense possibly damaging 0.76
IGL03048:Ncoa1 UTSW 12 4267922 missense probably damaging 0.96
IGL03147:Ncoa1 UTSW 12 4259342 missense probably damaging 1.00
PIT1430001:Ncoa1 UTSW 12 4323005 missense probably benign 0.19
PIT4402001:Ncoa1 UTSW 12 4294987 missense probably benign 0.00
R0002:Ncoa1 UTSW 12 4290885 missense probably benign 0.00
R0011:Ncoa1 UTSW 12 4322896 missense possibly damaging 0.94
R0389:Ncoa1 UTSW 12 4295976 missense probably benign 0.05
R0467:Ncoa1 UTSW 12 4267687 missense possibly damaging 0.49
R0480:Ncoa1 UTSW 12 4339105 missense probably damaging 1.00
R0541:Ncoa1 UTSW 12 4323033 missense probably damaging 1.00
R0671:Ncoa1 UTSW 12 4249758 splice site probably null
R1387:Ncoa1 UTSW 12 4274790 missense probably benign 0.01
R1426:Ncoa1 UTSW 12 4270737 splice site probably benign
R1538:Ncoa1 UTSW 12 4270748 missense possibly damaging 0.94
R1577:Ncoa1 UTSW 12 4295196 missense probably damaging 0.99
R1902:Ncoa1 UTSW 12 4339049 missense possibly damaging 0.78
R1905:Ncoa1 UTSW 12 4295433 missense probably damaging 1.00
R2026:Ncoa1 UTSW 12 4267647 missense probably benign 0.19
R2259:Ncoa1 UTSW 12 4315819 missense probably damaging 1.00
R2317:Ncoa1 UTSW 12 4275189 missense probably damaging 0.99
R3608:Ncoa1 UTSW 12 4278186 missense probably benign 0.00
R4042:Ncoa1 UTSW 12 4267871 missense probably damaging 0.99
R4688:Ncoa1 UTSW 12 4315781 missense probably benign 0.26
R4763:Ncoa1 UTSW 12 4275297 missense probably damaging 1.00
R4878:Ncoa1 UTSW 12 4275004 missense probably damaging 1.00
R5062:Ncoa1 UTSW 12 4259333 missense probably damaging 0.99
R5531:Ncoa1 UTSW 12 4253746 missense probably benign
R6393:Ncoa1 UTSW 12 4278181 missense probably benign 0.00
R6711:Ncoa1 UTSW 12 4322904 missense probably benign 0.26
R7066:Ncoa1 UTSW 12 4322934 missense possibly damaging 0.90
R7109:Ncoa1 UTSW 12 4322978 missense possibly damaging 0.63
R7170:Ncoa1 UTSW 12 4249722 missense probably benign 0.32
R7395:Ncoa1 UTSW 12 4295188 missense not run
R7453:Ncoa1 UTSW 12 4259307 missense probably damaging 1.00
R7556:Ncoa1 UTSW 12 4270794 missense probably damaging 0.98
R7821:Ncoa1 UTSW 12 4296221 missense probably benign 0.00
R7872:Ncoa1 UTSW 12 4278186 missense probably benign 0.00
R7885:Ncoa1 UTSW 12 4339044 missense probably damaging 1.00
R7936:Ncoa1 UTSW 12 4335873 missense possibly damaging 0.53
R7940:Ncoa1 UTSW 12 4313095 missense possibly damaging 0.50
R8176:Ncoa1 UTSW 12 4267858 missense possibly damaging 0.90
R8510:Ncoa1 UTSW 12 4259303 missense probably benign
Z1177:Ncoa1 UTSW 12 4306514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCAATAATGGAGCAAGACA -3'
(R):5'- CAATAAAGTTCCACTCCTATCTCTTC -3'

Sequencing Primer
(F):5'- CGTTTCCCCTAAGCACTTAAAATG -3'
(R):5'- CTTAATTCAGTCTCTGCCACGTTTG -3'
Posted On2020-06-30