Incidental Mutation 'R8126:Zdhhc20'
ID631779
Institutional Source Beutler Lab
Gene Symbol Zdhhc20
Ensembl Gene ENSMUSG00000021969
Gene Namezinc finger, DHHC domain containing 20
SynonymsB230110O18Rik, ENSMUSG00000055956, 5033406L14Rik, 4930542A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location57832703-57890276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57846945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 238 (V238F)
Ref Sequence ENSEMBL: ENSMUSP00000086900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089473] [ENSMUST00000226057]
Predicted Effect probably damaging
Transcript: ENSMUST00000089473
AA Change: V238F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086900
Gene: ENSMUSG00000021969
AA Change: V238F

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:zf-DHHC 121 250 2.2e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226057
AA Change: V250F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Other mutations in Zdhhc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zdhhc20 APN 14 57873924 missense probably damaging 0.99
IGL00983:Zdhhc20 APN 14 57839156 missense possibly damaging 0.62
IGL01107:Zdhhc20 APN 14 57865589 missense probably damaging 1.00
IGL01350:Zdhhc20 APN 14 57873987 missense probably benign 0.03
IGL02572:Zdhhc20 APN 14 57890107 missense probably benign 0.20
IGL02748:Zdhhc20 APN 14 57858553 missense probably benign 0.08
IGL03406:Zdhhc20 APN 14 57839099 missense probably benign
R0314:Zdhhc20 UTSW 14 57856619 missense probably damaging 1.00
R0631:Zdhhc20 UTSW 14 57857640 missense probably damaging 0.99
R1144:Zdhhc20 UTSW 14 57856678 missense probably benign 0.07
R1703:Zdhhc20 UTSW 14 57839088 critical splice donor site probably null
R1815:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R1816:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R6219:Zdhhc20 UTSW 14 57840883 missense probably damaging 0.99
R6488:Zdhhc20 UTSW 14 57840832 missense probably benign 0.00
R6650:Zdhhc20 UTSW 14 57858575 missense probably damaging 1.00
R6790:Zdhhc20 UTSW 14 57890143 missense probably benign 0.00
R7196:Zdhhc20 UTSW 14 57873891 critical splice donor site probably null
R7365:Zdhhc20 UTSW 14 57873920 missense possibly damaging 0.95
Z1176:Zdhhc20 UTSW 14 57839105 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCTATACATACAGTCACTCCTGC -3'
(R):5'- GGCGGAATCAGTCTTTATGAAG -3'

Sequencing Primer
(F):5'- ATACATACAGTCACTCCTGCACTTC -3'
(R):5'- CGGAATCAGTCTTTATGAAGAACCAG -3'
Posted On2020-06-30