Incidental Mutation 'R0707:Ankrd24'
ID63179
Institutional Source Beutler Lab
Gene Symbol Ankrd24
Ensembl Gene ENSMUSG00000054708
Gene Nameankyrin repeat domain 24
Synonyms4631433D01Rik, 5730519E19Rik, D10Bur2e
MMRRC Submission 038890-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R0707 (G1)
Quality Score85
Status Validated
Chromosome10
Chromosomal Location81628540-81647610 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 81642713 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119336] [ENSMUST00000123896] [ENSMUST00000123993] [ENSMUST00000126323] [ENSMUST00000152892]
Predicted Effect unknown
Transcript: ENSMUST00000119336
AA Change: Y502F
SMART Domains Protein: ENSMUSP00000112932
Gene: ENSMUSG00000054708
AA Change: Y502F

DomainStartEndE-ValueType
Blast:ANK 18 48 1e-6 BLAST
ANK 52 81 2.92e-2 SMART
ANK 85 114 7.53e-5 SMART
ANK 118 149 4.07e-1 SMART
ANK 151 180 2.92e-2 SMART
ANK 184 213 3.97e-4 SMART
low complexity region 240 250 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
internal_repeat_2 488 606 4.87e-8 PROSPERO
internal_repeat_2 597 713 4.87e-8 PROSPERO
low complexity region 718 736 N/A INTRINSIC
coiled coil region 747 895 N/A INTRINSIC
Blast:ANK 950 977 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123305
Predicted Effect probably benign
Transcript: ENSMUST00000123896
SMART Domains Protein: ENSMUSP00000116603
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
ANK 23 54 4.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123993
SMART Domains Protein: ENSMUSP00000117975
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ANK 48 78 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126323
SMART Domains Protein: ENSMUSP00000118286
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
ANK 7 36 2.92e-2 SMART
ANK 40 69 3.97e-4 SMART
low complexity region 96 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132458
SMART Domains Protein: ENSMUSP00000121709
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
coiled coil region 1 94 N/A INTRINSIC
Blast:ANK 142 175 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142390
Predicted Effect probably benign
Transcript: ENSMUST00000152892
SMART Domains Protein: ENSMUSP00000123676
Gene: ENSMUSG00000054708

DomainStartEndE-ValueType
ANK 24 53 7.53e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154707
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,258,321 N2881K unknown Het
Acot11 A G 4: 106,760,132 F259S probably damaging Het
Aldh16a1 T A 7: 45,144,507 probably benign Het
Arhgap5 T C 12: 52,518,168 S641P probably damaging Het
Arpp21 A C 9: 112,157,756 S242R probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Bud31 A G 5: 145,146,455 Y77C probably damaging Het
Ccdc65 G A 15: 98,709,214 V101I possibly damaging Het
Ccr7 T A 11: 99,145,983 T38S probably damaging Het
Cdc14a T C 3: 116,293,713 probably benign Het
Ces2f C T 8: 104,950,986 H208Y possibly damaging Het
Chst1 C A 2: 92,613,619 N145K possibly damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cog6 C T 3: 53,013,862 V108I possibly damaging Het
Crtc2 T A 3: 90,263,497 F626I probably damaging Het
Dicer1 A T 12: 104,706,885 F792I probably damaging Het
Dnajc13 T C 9: 104,172,582 K1780R probably benign Het
Dph5 A C 3: 115,915,133 N155H probably benign Het
Dscam T C 16: 96,825,782 probably null Het
Etl4 C A 2: 20,805,571 probably benign Het
Flt3l T C 7: 45,136,026 S9G probably benign Het
Fmnl2 A G 2: 53,054,486 E159G possibly damaging Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Herc6 G A 6: 57,662,362 G905E possibly damaging Het
Hhip T A 8: 79,998,255 N296I probably damaging Het
Hmgcr A T 13: 96,650,643 probably benign Het
Kalrn T G 16: 34,010,581 N723H possibly damaging Het
Mroh5 T A 15: 73,790,739 Y242F possibly damaging Het
Msh3 T A 13: 92,347,340 K258* probably null Het
Myo1a T C 10: 127,719,863 probably benign Het
Nlrp4f C T 13: 65,194,503 E443K probably benign Het
Nupr1l A G 5: 129,908,692 Y34C probably damaging Het
Ociad1 T C 5: 73,294,912 probably benign Het
Olfr1469 A T 19: 13,411,420 M284L probably benign Het
Olfr313 T A 11: 58,817,751 L248M probably damaging Het
Olfr366 A T 2: 37,220,196 K236* probably null Het
Olfr467 A G 7: 107,815,124 D182G probably damaging Het
Olfr522 T C 7: 140,162,089 N287S probably damaging Het
P2ry12 C A 3: 59,217,487 V256F probably damaging Het
Pcdhb22 T A 18: 37,518,851 I124N probably damaging Het
Pcnt A G 10: 76,420,541 F622L probably damaging Het
Pfas A T 11: 68,998,037 N361K probably benign Het
Plod2 T G 9: 92,605,427 L600V possibly damaging Het
Pole T C 5: 110,298,988 Y631H probably damaging Het
Proser1 T C 3: 53,478,776 L693P probably damaging Het
Ptprd A G 4: 75,957,239 Y1195H probably damaging Het
Rbm27 T A 18: 42,326,026 probably null Het
Ric8a A G 7: 140,857,973 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scfd1 A T 12: 51,412,577 K307M probably damaging Het
Sh2b2 A G 5: 136,232,263 F33S probably damaging Het
Smg7 T G 1: 152,870,757 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Strn3 G A 12: 51,610,404 T642I probably damaging Het
Syne2 T C 12: 75,982,063 probably null Het
Syne3 A G 12: 104,969,360 L53P probably damaging Het
Tcea1 T A 1: 4,880,346 probably benign Het
Tmem30b T C 12: 73,546,168 N58D probably benign Het
Tnpo1 A G 13: 98,855,446 Y641H probably damaging Het
Trim25 A T 11: 88,999,738 T84S probably benign Het
Trip4 A T 9: 65,839,004 F537I possibly damaging Het
Uaca G A 9: 60,848,618 probably benign Het
Ugt2b34 T A 5: 86,892,899 Y388F possibly damaging Het
Vmn2r71 T C 7: 85,619,432 V281A probably benign Het
Vps13d A T 4: 145,155,932 D1030E probably damaging Het
Vps8 C A 16: 21,442,357 F82L probably damaging Het
Zfp296 A G 7: 19,579,736 D172G probably benign Het
Zfp977 C A 7: 42,580,534 C189F probably damaging Het
Other mutations in Ankrd24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Ankrd24 APN 10 81643145 unclassified probably benign
IGL00809:Ankrd24 APN 10 81643067 unclassified probably benign
IGL01021:Ankrd24 APN 10 81635161 splice site probably null
IGL01073:Ankrd24 APN 10 81639322 missense possibly damaging 0.76
IGL01875:Ankrd24 APN 10 81629737 unclassified probably benign
IGL03083:Ankrd24 APN 10 81638649 missense probably benign
IGL03335:Ankrd24 APN 10 81647133 missense probably benign 0.18
R0129:Ankrd24 UTSW 10 81638329 missense probably damaging 1.00
R0243:Ankrd24 UTSW 10 81634944 missense probably damaging 1.00
R0522:Ankrd24 UTSW 10 81636355 splice site probably benign
R0607:Ankrd24 UTSW 10 81638308 missense probably damaging 0.98
R1472:Ankrd24 UTSW 10 81634920 missense probably damaging 1.00
R1766:Ankrd24 UTSW 10 81638638 missense probably benign 0.13
R1852:Ankrd24 UTSW 10 81642941 unclassified probably benign
R1891:Ankrd24 UTSW 10 81643508 unclassified probably benign
R2137:Ankrd24 UTSW 10 81646309 missense probably damaging 1.00
R3790:Ankrd24 UTSW 10 81642679 unclassified probably benign
R4798:Ankrd24 UTSW 10 81643315 unclassified probably benign
R4952:Ankrd24 UTSW 10 81647148 missense probably benign 0.01
R5068:Ankrd24 UTSW 10 81639865 missense possibly damaging 0.87
R5237:Ankrd24 UTSW 10 81642545 unclassified probably benign
R5418:Ankrd24 UTSW 10 81644942 unclassified probably benign
R5795:Ankrd24 UTSW 10 81645103 unclassified probably benign
R7188:Ankrd24 UTSW 10 81636390 nonsense probably null
R7614:Ankrd24 UTSW 10 81638689 missense unknown
R7750:Ankrd24 UTSW 10 81646794 missense possibly damaging 0.72
R8004:Ankrd24 UTSW 10 81638357 missense unknown
RF001:Ankrd24 UTSW 10 81643571 unclassified probably benign
RF011:Ankrd24 UTSW 10 81643571 unclassified probably benign
RF037:Ankrd24 UTSW 10 81643573 nonsense probably null
RF061:Ankrd24 UTSW 10 81643567 nonsense probably null
Z1088:Ankrd24 UTSW 10 81638656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGATGCACTGATGCCAAAGAACC -3'
(R):5'- ACCCCTGCTTCAGTATTCCAGACAC -3'

Sequencing Primer
(F):5'- GGAAATAGTTGCTTCCCTACAGG -3'
(R):5'- GTATTCCAGACACCCTTGGAGC -3'
Posted On2013-07-30