Incidental Mutation 'R8127:Ago1'
ID 631802
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission 067556-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.748) question?
Stock # R8127 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 126435012-126468583 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 126454421 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 342 (C342S)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000097888
AA Change: C342S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: C342S

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect probably benign
Transcript: ENSMUST00000176315
AA Change: C35S

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: C35S

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.9400 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,043,439 (GRCm38) M66T possibly damaging Het
Acvr1 A T 2: 58,477,626 (GRCm38) N174K probably benign Het
Anapc1 A G 2: 128,632,627 (GRCm38) S1423P probably damaging Het
Antxr2 A T 5: 97,980,017 (GRCm38) C218* probably null Het
Arsa A G 15: 89,474,864 (GRCm38) Y200H probably damaging Het
Atad3a C T 4: 155,753,939 (GRCm38) R207Q probably damaging Het
Carmil3 A G 14: 55,498,244 (GRCm38) D551G probably damaging Het
Cdk9 A G 2: 32,707,997 (GRCm38) I349T probably benign Het
Cmya5 A T 13: 93,094,614 (GRCm38) V1322E probably damaging Het
Col4a3 T A 1: 82,649,760 (GRCm38) I95K unknown Het
Dab2ip T C 2: 35,644,126 (GRCm38) probably benign Het
Dok7 A G 5: 35,087,001 (GRCm38) S530G probably benign Het
Dst C T 1: 34,178,229 (GRCm38) T1250M probably damaging Het
Dzank1 A C 2: 144,488,816 (GRCm38) W439G probably damaging Het
Evx1 T A 6: 52,313,917 (GRCm38) S25T possibly damaging Het
Fut10 G A 8: 31,194,971 (GRCm38) probably benign Het
Gatad1 T C 5: 3,643,540 (GRCm38) R210G probably benign Het
Hyal5 C A 6: 24,891,488 (GRCm38) R434S probably benign Het
Lrrc43 C T 5: 123,492,271 (GRCm38) P66S probably damaging Het
Mib1 T A 18: 10,741,031 (GRCm38) I93N probably damaging Het
Mug2 G A 6: 122,075,608 (GRCm38) E1038K probably benign Het
Nsd2 T A 5: 33,885,490 (GRCm38) C1033S probably damaging Het
Olfr424 C T 1: 174,137,589 (GRCm38) P282S probably damaging Het
Olfr985 T A 9: 40,127,064 (GRCm38) H299L probably benign Het
Otogl A T 10: 107,895,752 (GRCm38) F176Y probably damaging Het
Pih1d3 T C 1: 31,223,120 (GRCm38) F61S probably benign Het
Polr3b A G 10: 84,679,789 (GRCm38) K609E probably benign Het
Prdm15 T C 16: 97,837,710 (GRCm38) N50S probably benign Het
Rlf G T 4: 121,147,896 (GRCm38) Q1406K possibly damaging Het
Rusc2 T C 4: 43,423,747 (GRCm38) V1023A possibly damaging Het
Scn11a C T 9: 119,804,512 (GRCm38) G385D probably damaging Het
Slc44a1 T C 4: 53,528,714 (GRCm38) S155P probably benign Het
Spam1 T A 6: 24,796,971 (GRCm38) V307D possibly damaging Het
Srgap1 A C 10: 121,855,366 (GRCm38) M321R probably null Het
Stam A G 2: 14,117,473 (GRCm38) I128V probably damaging Het
Sytl2 A G 7: 90,375,590 (GRCm38) D262G possibly damaging Het
Taf2 G A 15: 55,059,988 (GRCm38) R298C probably damaging Het
Tcl1b5 A T 12: 105,180,003 (GRCm38) T112S probably benign Het
Trim33 T C 3: 103,331,727 (GRCm38) S674P possibly damaging Het
Trip12 T C 1: 84,738,742 (GRCm38) N1602S probably damaging Het
Vmn1r44 T C 6: 89,893,863 (GRCm38) I197T probably benign Het
Wdtc1 C T 4: 133,302,382 (GRCm38) probably null Het
Zfp583 G T 7: 6,323,822 (GRCm38) probably null Het
Zfyve16 T A 13: 92,505,677 (GRCm38) I1213F probably damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126,459,817 (GRCm38) missense probably damaging 0.98
IGL02578:Ago1 APN 4 126,439,531 (GRCm38) missense probably benign 0.12
IGL02709:Ago1 APN 4 126,453,640 (GRCm38) nonsense probably null
IGL02810:Ago1 APN 4 126,443,093 (GRCm38) missense probably benign 0.00
IGL03037:Ago1 APN 4 126,461,794 (GRCm38) missense probably benign 0.00
IGL03091:Ago1 APN 4 126,459,189 (GRCm38) missense probably damaging 0.98
IGL03100:Ago1 APN 4 126,443,171 (GRCm38) missense probably benign 0.08
IGL03121:Ago1 APN 4 126,460,003 (GRCm38) missense probably benign 0.00
R0195:Ago1 UTSW 4 126,463,691 (GRCm38) missense probably benign 0.01
R0244:Ago1 UTSW 4 126,463,706 (GRCm38) missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126,443,166 (GRCm38) missense probably benign 0.06
R0514:Ago1 UTSW 4 126,439,595 (GRCm38) missense probably benign
R0557:Ago1 UTSW 4 126,460,024 (GRCm38) missense probably benign 0.00
R1104:Ago1 UTSW 4 126,453,633 (GRCm38) missense probably damaging 0.99
R1553:Ago1 UTSW 4 126,440,401 (GRCm38) missense probably damaging 0.99
R1624:Ago1 UTSW 4 126,463,741 (GRCm38) missense probably damaging 0.97
R1851:Ago1 UTSW 4 126,439,995 (GRCm38) missense probably benign 0.00
R1867:Ago1 UTSW 4 126,441,236 (GRCm38) missense probably damaging 0.98
R2001:Ago1 UTSW 4 126,454,394 (GRCm38) missense probably null 0.36
R2051:Ago1 UTSW 4 126,460,453 (GRCm38) missense probably benign 0.01
R2057:Ago1 UTSW 4 126,443,228 (GRCm38) missense probably damaging 0.98
R2105:Ago1 UTSW 4 126,461,788 (GRCm38) missense probably benign 0.30
R2117:Ago1 UTSW 4 126,463,857 (GRCm38) splice site probably null
R2256:Ago1 UTSW 4 126,441,911 (GRCm38) missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126,453,650 (GRCm38) missense probably benign 0.01
R2517:Ago1 UTSW 4 126,439,939 (GRCm38) nonsense probably null
R2850:Ago1 UTSW 4 126,443,075 (GRCm38) splice site probably benign
R2993:Ago1 UTSW 4 126,440,046 (GRCm38) splice site probably benign
R3746:Ago1 UTSW 4 126,461,044 (GRCm38) missense probably benign
R3747:Ago1 UTSW 4 126,461,044 (GRCm38) missense probably benign
R3750:Ago1 UTSW 4 126,461,044 (GRCm38) missense probably benign
R4600:Ago1 UTSW 4 126,460,392 (GRCm38) missense probably benign 0.37
R4934:Ago1 UTSW 4 126,448,859 (GRCm38) missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126,453,654 (GRCm38) missense probably damaging 0.99
R5086:Ago1 UTSW 4 126,453,604 (GRCm38) missense probably benign 0.01
R5132:Ago1 UTSW 4 126,461,723 (GRCm38) missense probably benign 0.01
R5239:Ago1 UTSW 4 126,441,215 (GRCm38) missense probably damaging 1.00
R5609:Ago1 UTSW 4 126,461,037 (GRCm38) missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126,448,794 (GRCm38) missense probably benign 0.01
R5980:Ago1 UTSW 4 126,460,569 (GRCm38) unclassified probably benign
R6036:Ago1 UTSW 4 126,443,228 (GRCm38) missense probably damaging 0.98
R6036:Ago1 UTSW 4 126,443,228 (GRCm38) missense probably damaging 0.98
R6398:Ago1 UTSW 4 126,448,808 (GRCm38) missense probably benign 0.26
R6505:Ago1 UTSW 4 126,463,835 (GRCm38) missense probably benign 0.00
R6545:Ago1 UTSW 4 126,454,352 (GRCm38) missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126,460,422 (GRCm38) missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126,463,706 (GRCm38) missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126,439,505 (GRCm38) makesense probably null
R7496:Ago1 UTSW 4 126,461,752 (GRCm38) missense probably benign 0.20
R7575:Ago1 UTSW 4 126,453,908 (GRCm38) missense probably benign 0.12
R7625:Ago1 UTSW 4 126,443,229 (GRCm38) missense probably benign 0.18
R7988:Ago1 UTSW 4 126,460,417 (GRCm38) missense probably damaging 1.00
R8041:Ago1 UTSW 4 126,441,936 (GRCm38) missense probably damaging 1.00
R8073:Ago1 UTSW 4 126,443,226 (GRCm38) missense probably benign 0.04
R8086:Ago1 UTSW 4 126,460,981 (GRCm38) missense probably benign
R8772:Ago1 UTSW 4 126,460,523 (GRCm38) unclassified probably benign
R8878:Ago1 UTSW 4 126,463,723 (GRCm38) missense probably benign 0.35
R8989:Ago1 UTSW 4 126,463,790 (GRCm38) missense probably benign 0.01
R9140:Ago1 UTSW 4 126,443,184 (GRCm38) missense probably benign
X0025:Ago1 UTSW 4 126,443,115 (GRCm38) missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126,453,656 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCTACTAAGGGCCCCGAAG -3'
(R):5'- AGATCCGTGTACTTAGTCCTTG -3'

Sequencing Primer
(F):5'- GTCTCAGTGAACAGCAGCACG -3'
(R):5'- AGTGCTGCATTTAATCTCTAGACACC -3'
Posted On 2020-06-30