Incidental Mutation 'R8127:Ago1'
ID631802
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Nameargonaute RISC catalytic subunit 1
SynonymsEif2c1, argonaute 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.626) question?
Stock #R8127 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126435012-126468583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126454421 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 342 (C342S)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097888
AA Change: C342S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: C342S

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect probably benign
Transcript: ENSMUST00000176315
AA Change: C35S

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530
AA Change: C35S

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.9400 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,043,439 M66T possibly damaging Het
Acvr1 A T 2: 58,477,626 N174K probably benign Het
Anapc1 A G 2: 128,632,627 S1423P probably damaging Het
Antxr2 A T 5: 97,980,017 C218* probably null Het
Arsa A G 15: 89,474,864 Y200H probably damaging Het
Atad3a C T 4: 155,753,939 R207Q probably damaging Het
Carmil3 A G 14: 55,498,244 D551G probably damaging Het
Cdk9 A G 2: 32,707,997 I349T probably benign Het
Cmya5 A T 13: 93,094,614 V1322E probably damaging Het
Col4a3 T A 1: 82,649,760 I95K unknown Het
Dab2ip T C 2: 35,644,126 probably benign Het
Dok7 A G 5: 35,087,001 S530G probably benign Het
Dst C T 1: 34,178,229 T1250M probably damaging Het
Dzank1 A C 2: 144,488,816 W439G probably damaging Het
Evx1 T A 6: 52,313,917 S25T possibly damaging Het
Fut10 G A 8: 31,194,971 probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Hyal5 C A 6: 24,891,488 R434S probably benign Het
Lrrc43 C T 5: 123,492,271 P66S probably damaging Het
Mib1 T A 18: 10,741,031 I93N probably damaging Het
Mug2 G A 6: 122,075,608 E1038K probably benign Het
Nsd2 T A 5: 33,885,490 C1033S probably damaging Het
Olfr424 C T 1: 174,137,589 P282S probably damaging Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Otogl A T 10: 107,895,752 F176Y probably damaging Het
Pih1d3 T C 1: 31,223,120 F61S probably benign Het
Polr3b A G 10: 84,679,789 K609E probably benign Het
Prdm15 T C 16: 97,837,710 N50S probably benign Het
Rlf G T 4: 121,147,896 Q1406K possibly damaging Het
Rusc2 T C 4: 43,423,747 V1023A possibly damaging Het
Scn11a C T 9: 119,804,512 G385D probably damaging Het
Slc44a1 T C 4: 53,528,714 S155P probably benign Het
Spam1 T A 6: 24,796,971 V307D possibly damaging Het
Srgap1 A C 10: 121,855,366 M321R probably null Het
Stam A G 2: 14,117,473 I128V probably damaging Het
Sytl2 A G 7: 90,375,590 D262G possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tcl1b5 A T 12: 105,180,003 T112S probably benign Het
Trim33 T C 3: 103,331,727 S674P possibly damaging Het
Trip12 T C 1: 84,738,742 N1602S probably damaging Het
Vmn1r44 T C 6: 89,893,863 I197T probably benign Het
Wdtc1 C T 4: 133,302,382 probably null Het
Zfp583 G T 7: 6,323,822 probably null Het
Zfyve16 T A 13: 92,505,677 I1213F probably damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 splice site probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R7988:Ago1 UTSW 4 126460417 missense probably damaging 1.00
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
R8086:Ago1 UTSW 4 126460981 missense probably benign
R8878:Ago1 UTSW 4 126463723 missense probably benign 0.35
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCTACTAAGGGCCCCGAAG -3'
(R):5'- AGATCCGTGTACTTAGTCCTTG -3'

Sequencing Primer
(F):5'- GTCTCAGTGAACAGCAGCACG -3'
(R):5'- AGTGCTGCATTTAATCTCTAGACACC -3'
Posted On2020-06-30