Incidental Mutation 'R8127:Mug2'
ID 631815
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8127 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 122075608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1038 (E1038K)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: E1038K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: E1038K

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,043,439 M66T possibly damaging Het
Acvr1 A T 2: 58,477,626 N174K probably benign Het
Ago1 A T 4: 126,454,421 C342S possibly damaging Het
Anapc1 A G 2: 128,632,627 S1423P probably damaging Het
Antxr2 A T 5: 97,980,017 C218* probably null Het
Arsa A G 15: 89,474,864 Y200H probably damaging Het
Atad3a C T 4: 155,753,939 R207Q probably damaging Het
Carmil3 A G 14: 55,498,244 D551G probably damaging Het
Cdk9 A G 2: 32,707,997 I349T probably benign Het
Cmya5 A T 13: 93,094,614 V1322E probably damaging Het
Col4a3 T A 1: 82,649,760 I95K unknown Het
Dab2ip T C 2: 35,644,126 probably benign Het
Dok7 A G 5: 35,087,001 S530G probably benign Het
Dst C T 1: 34,178,229 T1250M probably damaging Het
Dzank1 A C 2: 144,488,816 W439G probably damaging Het
Evx1 T A 6: 52,313,917 S25T possibly damaging Het
Fut10 G A 8: 31,194,971 probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Hyal5 C A 6: 24,891,488 R434S probably benign Het
Lrrc43 C T 5: 123,492,271 P66S probably damaging Het
Mib1 T A 18: 10,741,031 I93N probably damaging Het
Nsd2 T A 5: 33,885,490 C1033S probably damaging Het
Olfr424 C T 1: 174,137,589 P282S probably damaging Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Otogl A T 10: 107,895,752 F176Y probably damaging Het
Pih1d3 T C 1: 31,223,120 F61S probably benign Het
Polr3b A G 10: 84,679,789 K609E probably benign Het
Prdm15 T C 16: 97,837,710 N50S probably benign Het
Rlf G T 4: 121,147,896 Q1406K possibly damaging Het
Rusc2 T C 4: 43,423,747 V1023A possibly damaging Het
Scn11a C T 9: 119,804,512 G385D probably damaging Het
Slc44a1 T C 4: 53,528,714 S155P probably benign Het
Spam1 T A 6: 24,796,971 V307D possibly damaging Het
Srgap1 A C 10: 121,855,366 M321R probably null Het
Stam A G 2: 14,117,473 I128V probably damaging Het
Sytl2 A G 7: 90,375,590 D262G possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tcl1b5 A T 12: 105,180,003 T112S probably benign Het
Trim33 T C 3: 103,331,727 S674P possibly damaging Het
Trip12 T C 1: 84,738,742 N1602S probably damaging Het
Vmn1r44 T C 6: 89,893,863 I197T probably benign Het
Wdtc1 C T 4: 133,302,382 probably null Het
Zfp583 G T 7: 6,323,822 probably null Het
Zfyve16 T A 13: 92,505,677 I1213F probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122084369 missense probably damaging 1.00
R9153:Mug2 UTSW 6 122040668 missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122077483 missense probably benign 0.06
R9186:Mug2 UTSW 6 122075289 missense probably damaging 0.99
R9418:Mug2 UTSW 6 122040741 missense probably benign 0.00
R9464:Mug2 UTSW 6 122051731 missense probably benign 0.01
R9622:Mug2 UTSW 6 122051792 missense probably benign 0.29
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATCAGTCCTATAAGCCAGG -3'
(R):5'- GCCAGGAAAGCACATGGTAC -3'

Sequencing Primer
(F):5'- TCAGTCCTATAAGCCAGGGTATG -3'
(R):5'- AGATGAGACTCGGGGAATCTTAGTTC -3'
Posted On 2020-06-30