Incidental Mutation 'R8127:Arsa'
ID631828
Institutional Source Beutler Lab
Gene Symbol Arsa
Ensembl Gene ENSMUSG00000022620
Gene Namearylsulfatase A
SynonymsAs2, As-2, ASA, AS-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R8127 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89472476-89477425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89474864 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 200 (Y200H)
Ref Sequence ENSEMBL: ENSMUSP00000127646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165199]
Predicted Effect probably damaging
Transcript: ENSMUST00000165199
AA Change: Y200H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127646
Gene: ENSMUSG00000022620
AA Change: Y200H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Sulfatase 20 345 4.2e-79 PFAM
Pfam:Sulfatase_C 367 501 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168270
SMART Domains Protein: ENSMUSP00000130574
Gene: ENSMUSG00000022620

DomainStartEndE-ValueType
Pfam:Sulfatase 1 37 1e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mice exhibit impaired balance and spatial learning ability. Sulfatide accumulates in the white matter of the brain and a reduced myelin sheath thickness in the corpus callosum and optic nerves is seen. A low frequency of head tremor develops after 2 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,043,439 M66T possibly damaging Het
Acvr1 A T 2: 58,477,626 N174K probably benign Het
Ago1 A T 4: 126,454,421 C342S possibly damaging Het
Anapc1 A G 2: 128,632,627 S1423P probably damaging Het
Antxr2 A T 5: 97,980,017 C218* probably null Het
Atad3a C T 4: 155,753,939 R207Q probably damaging Het
Carmil3 A G 14: 55,498,244 D551G probably damaging Het
Cdk9 A G 2: 32,707,997 I349T probably benign Het
Cmya5 A T 13: 93,094,614 V1322E probably damaging Het
Col4a3 T A 1: 82,649,760 I95K unknown Het
Dab2ip T C 2: 35,644,126 probably benign Het
Dok7 A G 5: 35,087,001 S530G probably benign Het
Dst C T 1: 34,178,229 T1250M probably damaging Het
Dzank1 A C 2: 144,488,816 W439G probably damaging Het
Evx1 T A 6: 52,313,917 S25T possibly damaging Het
Fut10 G A 8: 31,194,971 probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Hyal5 C A 6: 24,891,488 R434S probably benign Het
Lrrc43 C T 5: 123,492,271 P66S probably damaging Het
Mib1 T A 18: 10,741,031 I93N probably damaging Het
Mug2 G A 6: 122,075,608 E1038K probably benign Het
Nsd2 T A 5: 33,885,490 C1033S probably damaging Het
Olfr424 C T 1: 174,137,589 P282S probably damaging Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Otogl A T 10: 107,895,752 F176Y probably damaging Het
Pih1d3 T C 1: 31,223,120 F61S probably benign Het
Polr3b A G 10: 84,679,789 K609E probably benign Het
Prdm15 T C 16: 97,837,710 N50S probably benign Het
Rlf G T 4: 121,147,896 Q1406K possibly damaging Het
Rusc2 T C 4: 43,423,747 V1023A possibly damaging Het
Scn11a C T 9: 119,804,512 G385D probably damaging Het
Slc44a1 T C 4: 53,528,714 S155P probably benign Het
Spam1 T A 6: 24,796,971 V307D possibly damaging Het
Srgap1 A C 10: 121,855,366 M321R probably null Het
Stam A G 2: 14,117,473 I128V probably damaging Het
Sytl2 A G 7: 90,375,590 D262G possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tcl1b5 A T 12: 105,180,003 T112S probably benign Het
Trim33 T C 3: 103,331,727 S674P possibly damaging Het
Trip12 T C 1: 84,738,742 N1602S probably damaging Het
Vmn1r44 T C 6: 89,893,863 I197T probably benign Het
Wdtc1 C T 4: 133,302,382 probably null Het
Zfp583 G T 7: 6,323,822 probably null Het
Zfyve16 T A 13: 92,505,677 I1213F probably damaging Het
Other mutations in Arsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Arsa APN 15 89473351 missense probably benign 0.04
IGL02381:Arsa APN 15 89475537 nonsense probably null
IGL02416:Arsa APN 15 89474788 missense probably damaging 1.00
IGL02997:Arsa APN 15 89474038 missense probably damaging 0.99
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0630:Arsa UTSW 15 89474004 splice site probably benign
R1052:Arsa UTSW 15 89475177 missense probably damaging 1.00
R1079:Arsa UTSW 15 89474225 splice site probably benign
R1807:Arsa UTSW 15 89475322 missense possibly damaging 0.54
R1943:Arsa UTSW 15 89473539 missense probably damaging 1.00
R2231:Arsa UTSW 15 89475722 start codon destroyed probably null
R5099:Arsa UTSW 15 89475339 missense probably damaging 1.00
R5461:Arsa UTSW 15 89473275 missense probably benign
R6259:Arsa UTSW 15 89475521 missense probably damaging 1.00
R7159:Arsa UTSW 15 89474718 splice site probably null
R7188:Arsa UTSW 15 89475627 nonsense probably null
R7735:Arsa UTSW 15 89474949 nonsense probably null
R7943:Arsa UTSW 15 89474089 missense probably damaging 1.00
R8287:Arsa UTSW 15 89473390 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCATCAAGGAGTCCCCAAATGG -3'
(R):5'- ACTGTACCCTAACCCGTAGC -3'

Sequencing Primer
(F):5'- GAAGCTTTGTCCACTGAACTGAG -3'
(R):5'- TAACCCGTAGCCAGTCCTC -3'
Posted On2020-06-30