Incidental Mutation 'R8128:Olfr469'
ID631851
Institutional Source Beutler Lab
Gene Symbol Olfr469
Ensembl Gene ENSMUSG00000095910
Gene Nameolfactory receptor 469
SynonymsMOR204-21, GA_x6K02T2PBJ9-10152980-10152036
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8128 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107820566-107825541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 107823425 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 15 (F15V)
Ref Sequence ENSEMBL: ENSMUSP00000150486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075704] [ENSMUST00000213252]
Predicted Effect probably damaging
Transcript: ENSMUST00000075704
AA Change: F15V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075122
Gene: ENSMUSG00000095910
AA Change: F15V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.3e-53 PFAM
Pfam:7tm_1 44 293 2.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213252
AA Change: F15V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.6%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,958,395 R1188G probably damaging Het
Abcc5 G A 16: 20,365,723 R1036C probably damaging Het
Arhgap22 T A 14: 33,367,085 F508I probably benign Het
Bahcc1 C T 11: 120,272,390 Q505* probably null Het
Birc6 T A 17: 74,609,258 L1723Q probably damaging Het
Caprin2 A G 6: 148,883,442 probably null Het
Cfap69 C A 5: 5,596,034 M555I probably benign Het
Cgn C T 3: 94,769,381 A773T probably benign Het
Cnot7 A G 8: 40,510,088 V15A probably damaging Het
Col7a1 A G 9: 108,955,721 R206G unknown Het
Dscam C A 16: 96,801,174 probably null Het
Eif3k A T 7: 28,980,317 probably benign Het
Epn2 G T 11: 61,522,495 probably null Het
Fitm2 T C 2: 163,469,648 D215G probably benign Het
Foxa3 A T 7: 19,023,416 M1K probably null Het
Glyctk T C 9: 106,155,302 H504R probably benign Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Grin3b T C 10: 79,977,110 L394P Het
Hgh1 A G 15: 76,370,381 Y319C probably damaging Het
Hk1 T C 10: 62,281,843 T635A probably benign Het
Igsf3 T A 3: 101,439,631 N627K probably damaging Het
Lmtk3 G T 7: 45,794,174 M760I Het
Lrp1b G A 2: 41,269,236 A1678V probably null Het
Lrrc8c A T 5: 105,607,622 N421I probably damaging Het
Mfsd13b C A 7: 120,991,272 R79S possibly damaging Het
Olfr357 A T 2: 36,997,661 M284L probably benign Het
Pappa2 T C 1: 158,936,664 T426A possibly damaging Het
Pkhd1l1 A T 15: 44,498,053 I500F possibly damaging Het
Polr3gl T A 3: 96,580,508 probably null Het
Psmg3 A G 5: 139,824,033 V86A probably damaging Het
Ptgs2 T A 1: 150,101,348 V102E probably damaging Het
Rhpn1 T C 15: 75,711,183 probably null Het
Scand1 T C 2: 156,312,041 D103G probably damaging Het
Serpinb6d T C 13: 33,666,400 I70T possibly damaging Het
Slco3a1 A T 7: 74,284,301 S708T probably damaging Het
Sprr2d G A 3: 92,340,453 C67Y unknown Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Trafd1 G T 5: 121,372,402 P567Q possibly damaging Het
Trim32 A G 4: 65,613,445 N80D probably damaging Het
Vmn1r193 A G 13: 22,218,943 L293S probably damaging Het
Vmn2r12 A T 5: 109,091,881 M272K possibly damaging Het
Vmn2r90 T A 17: 17,733,893 L773Q probably damaging Het
Other mutations in Olfr469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02205:Olfr469 APN 7 107822591 missense probably damaging 1.00
IGL02252:Olfr469 APN 7 107823146 missense probably benign 0.04
R0365:Olfr469 UTSW 7 107822917 nonsense probably null
R0647:Olfr469 UTSW 7 107823011 missense probably benign 0.02
R0863:Olfr469 UTSW 7 107823374 missense probably benign
R1830:Olfr469 UTSW 7 107823371 missense probably benign 0.02
R2189:Olfr469 UTSW 7 107822615 missense probably benign 0.09
R2316:Olfr469 UTSW 7 107822800 missense probably benign 0.25
R6187:Olfr469 UTSW 7 107822574 missense probably benign
R6305:Olfr469 UTSW 7 107822657 missense probably benign 0.01
R6774:Olfr469 UTSW 7 107823188 missense probably benign 0.06
R7019:Olfr469 UTSW 7 107823158 missense probably benign 0.04
R7205:Olfr469 UTSW 7 107822575 missense probably benign 0.01
R7466:Olfr469 UTSW 7 107822922 nonsense probably null
R8251:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
R8252:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
R8253:Olfr469 UTSW 7 107822569 missense probably damaging 0.98
Z1176:Olfr469 UTSW 7 107822993 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGTCAACAGAAGCCAAGTG -3'
(R):5'- AGGCACTTTGAGCACATTTAATAAC -3'

Sequencing Primer
(F):5'- ACAGTCACCAGGTAGATG -3'
(R):5'- GAGTTAATGAGAATGGTGCT -3'
Posted On2020-06-30