Mutagenetix > Incidental Mutation

Incidental Mutation 'R8129:Tbx15'

631886

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R8129 (G1)

Quality Score

204.009

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 99253938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 20 (V20F)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: V20F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: V20F

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.0%
20x: 85.2%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	C	2: 35,376,175	D161G	probably damaging	Het
Adamts19	T	C	18: 59,007,487		probably null	Het
Ahnak	A	T	19: 9,000,100	M1L	not run	Het
Appl1	A	G	14: 26,949,509	S329P	possibly damaging	Het
Bach1	C	T	16: 87,722,426	R535W	possibly damaging	Het
Bicc1	T	C	10: 71,079,203	D77G	probably benign	Het
Bub1b	T	A	2: 118,638,494	D913E	probably benign	Het
Cdhr2	G	T	13: 54,716,395		probably null	Het
Col25a1	T	C	3: 130,496,401	S247P	probably damaging	Het
Commd8	T	C	5: 72,162,821	M126V	unknown	Het
Dpysl4	C	T	7: 139,086,160	T13M	probably benign	Het
Epc1	A	G	18: 6,439,634	V776A	possibly damaging	Het
Fancg	G	T	4: 43,005,036		probably null	Het
Fdx1	T	C	9: 51,948,626	T135A	probably benign	Het
Fgf7	T	C	2: 126,035,845	V44A	probably benign	Het
Fgfr3	A	T	5: 33,733,906	M523L	probably damaging	Het
Focad	A	T	4: 88,232,763	H548L	unknown	Het
Ftsj3	C	A	11: 106,253,831	V111F	probably benign	Het
Gm28168	T	A	1: 117,929,753	D12E	probably damaging	Het
Gprin3	T	C	6: 59,353,859	T488A	probably benign	Het
Hormad2	C	A	11: 4,346,648	V279L	probably benign	Het
Hs6st1	A	G	1: 36,069,024	K123E	probably damaging	Het
Ice1	A	G	13: 70,606,201	S589P	probably benign	Het
Il1r1	T	A	1: 40,302,287	H286Q	probably benign	Het
Il1rl1	T	A	1: 40,451,827	C423S	probably damaging	Het
L1td1	A	T	4: 98,733,326	M42L	probably benign	Het
Large1	T	C	8: 72,815,957	D713G	probably damaging	Het
Llgl2	C	A	11: 115,850,911		probably null	Het
Lrp2	C	T	2: 69,430,280	V4536M	possibly damaging	Het
Map3k19	A	C	1: 127,822,683	L977R	possibly damaging	Het
Myo15	A	T	11: 60,508,200	D1617V		Het
Nek3	A	G	8: 22,149,892	I189T	probably damaging	Het
Nrap	C	T	19: 56,366,636		probably null	Het
Olfr1249	C	A	2: 89,630,448	G150V	probably damaging	Het
Olfr1375	G	A	11: 51,048,383	R92K	probably benign	Het
Olfr1474	A	T	19: 13,471,144	Y16F	probably damaging	Het
Olfr652	A	G	7: 104,564,377	Y52C	probably benign	Het
Omd	A	C	13: 49,592,089	D325A	probably damaging	Het
Pabpc6	C	T	17: 9,668,498	V375I	possibly damaging	Het
Pcdha5	A	G	18: 36,961,779	D447G	probably damaging	Het
Pla2r1	A	T	2: 60,432,600	W1032R	probably damaging	Het
Ppp2r5d	T	C	17: 46,684,337	Y524C	probably benign	Het
Ppp4r3b	T	C	11: 29,209,364	Y573H	probably damaging	Het
Prune2	T	C	19: 17,118,836	I568T	probably benign	Het
Ptpn22	G	A	3: 103,890,284		probably null	Het
Rbm12b1	A	G	4: 12,145,549	D507G	probably damaging	Het
Rdh7	A	G	10: 127,887,501	S162P	probably benign	Het
Rreb1	C	T	13: 37,929,799	A378V	probably benign	Het
Scaf11	A	G	15: 96,419,469	F738S	probably damaging	Het
Sdk1	C	A	5: 142,191,893	N2031K	probably benign	Het
Serpina3c	A	T	12: 104,151,797	L94Q	probably damaging	Het
Sgo2b	T	C	8: 63,928,800	S333G	possibly damaging	Het
Slc22a15	A	G	3: 101,915,342	V88A	possibly damaging	Het
Smarcad1	G	T	6: 65,067,094	D217Y	probably benign	Het
Sppl2a	A	G	2: 126,923,470	F244S	probably damaging	Het
Sspo	G	A	6: 48,467,025	D2156N	possibly damaging	Het
Taf2	G	A	15: 55,059,988	R298C	probably damaging	Het
Tap2	C	T	17: 34,205,698	T135I	probably benign	Het
Tes	A	T	6: 17,065,243		probably benign	Het
Tmem39b	A	T	4: 129,678,675	M378K	probably damaging	Het
Trim44	A	G	2: 102,400,503	V61A	unknown	Het
Ttll5	T	C	12: 85,891,084		probably null	Het
Tubgcp4	C	T	2: 121,173,628	T50I	possibly damaging	Het
Txndc17	G	A	11: 72,207,762	V47M	probably damaging	Het
Ubp1	A	G	9: 113,975,349	E494G	possibly damaging	Het
Utp20	A	T	10: 88,792,625	S936T	probably benign	Het
Wdr64	A	G	1: 175,775,588	D585G	probably damaging	Het
Wdtc1	A	T	4: 133,304,149		probably null	Het
Zfp292	A	G	4: 34,807,386	M1891T	probably damaging	Het
Zfp84	A	C	7: 29,776,437	I185L	probably benign	Het
Zmym4	A	G	4: 126,915,163	F364L	possibly damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCAGCAGAGTTTGTGAGCG -3'
(R):5'- GGCTCAAGGTATTTATGCCAAG -3'

Sequencing Primer
(F):5'- AGCTGGACTCAGTGCTCCATG -3'
(R):5'- GTATTTATGCCAAGAAAAAGGAACCC -3'

Posted On

2020-06-30