Incidental Mutation 'R8129:Ptpn22'
ID631888
Institutional Source Beutler Lab
Gene Symbol Ptpn22
Ensembl Gene ENSMUSG00000027843
Gene Nameprotein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms70zpep, Ptpn8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R8129 (G1)
Quality Score112.008
Status Validated
Chromosome3
Chromosomal Location103859795-103912247 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 103890284 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000146071]
PDB Structure Solution structure of the SH3 domain from C-terminal Src Kinase complexed with a peptide from the tyrosine phosphatase PEP [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000029433
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000146071
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 85.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,175 D161G probably damaging Het
Adamts19 T C 18: 59,007,487 probably null Het
Ahnak A T 19: 9,000,100 M1L not run Het
Appl1 A G 14: 26,949,509 S329P possibly damaging Het
Bach1 C T 16: 87,722,426 R535W possibly damaging Het
Bicc1 T C 10: 71,079,203 D77G probably benign Het
Bub1b T A 2: 118,638,494 D913E probably benign Het
Cdhr2 G T 13: 54,716,395 probably null Het
Col25a1 T C 3: 130,496,401 S247P probably damaging Het
Commd8 T C 5: 72,162,821 M126V unknown Het
Dpysl4 C T 7: 139,086,160 T13M probably benign Het
Epc1 A G 18: 6,439,634 V776A possibly damaging Het
Fancg G T 4: 43,005,036 probably null Het
Fdx1 T C 9: 51,948,626 T135A probably benign Het
Fgf7 T C 2: 126,035,845 V44A probably benign Het
Fgfr3 A T 5: 33,733,906 M523L probably damaging Het
Focad A T 4: 88,232,763 H548L unknown Het
Ftsj3 C A 11: 106,253,831 V111F probably benign Het
Gm28168 T A 1: 117,929,753 D12E probably damaging Het
Gprin3 T C 6: 59,353,859 T488A probably benign Het
Hormad2 C A 11: 4,346,648 V279L probably benign Het
Hs6st1 A G 1: 36,069,024 K123E probably damaging Het
Ice1 A G 13: 70,606,201 S589P probably benign Het
Il1r1 T A 1: 40,302,287 H286Q probably benign Het
Il1rl1 T A 1: 40,451,827 C423S probably damaging Het
L1td1 A T 4: 98,733,326 M42L probably benign Het
Large1 T C 8: 72,815,957 D713G probably damaging Het
Llgl2 C A 11: 115,850,911 probably null Het
Lrp2 C T 2: 69,430,280 V4536M possibly damaging Het
Map3k19 A C 1: 127,822,683 L977R possibly damaging Het
Myo15 A T 11: 60,508,200 D1617V Het
Nek3 A G 8: 22,149,892 I189T probably damaging Het
Nrap C T 19: 56,366,636 probably null Het
Olfr1249 C A 2: 89,630,448 G150V probably damaging Het
Olfr1375 G A 11: 51,048,383 R92K probably benign Het
Olfr1474 A T 19: 13,471,144 Y16F probably damaging Het
Olfr652 A G 7: 104,564,377 Y52C probably benign Het
Omd A C 13: 49,592,089 D325A probably damaging Het
Pabpc6 C T 17: 9,668,498 V375I possibly damaging Het
Pcdha5 A G 18: 36,961,779 D447G probably damaging Het
Pla2r1 A T 2: 60,432,600 W1032R probably damaging Het
Ppp2r5d T C 17: 46,684,337 Y524C probably benign Het
Ppp4r3b T C 11: 29,209,364 Y573H probably damaging Het
Prune2 T C 19: 17,118,836 I568T probably benign Het
Rbm12b1 A G 4: 12,145,549 D507G probably damaging Het
Rdh7 A G 10: 127,887,501 S162P probably benign Het
Rreb1 C T 13: 37,929,799 A378V probably benign Het
Scaf11 A G 15: 96,419,469 F738S probably damaging Het
Sdk1 C A 5: 142,191,893 N2031K probably benign Het
Serpina3c A T 12: 104,151,797 L94Q probably damaging Het
Sgo2b T C 8: 63,928,800 S333G possibly damaging Het
Slc22a15 A G 3: 101,915,342 V88A possibly damaging Het
Smarcad1 G T 6: 65,067,094 D217Y probably benign Het
Sppl2a A G 2: 126,923,470 F244S probably damaging Het
Sspo G A 6: 48,467,025 D2156N possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tap2 C T 17: 34,205,698 T135I probably benign Het
Tbx15 G T 3: 99,253,938 V20F probably damaging Het
Tes A T 6: 17,065,243 probably benign Het
Tmem39b A T 4: 129,678,675 M378K probably damaging Het
Trim44 A G 2: 102,400,503 V61A unknown Het
Ttll5 T C 12: 85,891,084 probably null Het
Tubgcp4 C T 2: 121,173,628 T50I possibly damaging Het
Txndc17 G A 11: 72,207,762 V47M probably damaging Het
Ubp1 A G 9: 113,975,349 E494G possibly damaging Het
Utp20 A T 10: 88,792,625 S936T probably benign Het
Wdr64 A G 1: 175,775,588 D585G probably damaging Het
Wdtc1 A T 4: 133,304,149 probably null Het
Zfp292 A G 4: 34,807,386 M1891T probably damaging Het
Zfp84 A C 7: 29,776,437 I185L probably benign Het
Zmym4 A G 4: 126,915,163 F364L possibly damaging Het
Other mutations in Ptpn22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Ptpn22 APN 3 103903374 missense probably benign 0.01
IGL01373:Ptpn22 APN 3 103886204 missense probably damaging 0.99
IGL01943:Ptpn22 APN 3 103886336 missense probably benign 0.02
IGL02092:Ptpn22 APN 3 103877321 missense probably damaging 1.00
IGL02431:Ptpn22 APN 3 103903397 missense probably benign 0.01
IGL02732:Ptpn22 APN 3 103886033 missense probably damaging 0.98
IGL02738:Ptpn22 APN 3 103874066 splice site probably benign
IGL03406:Ptpn22 APN 3 103912016 missense probably benign 0.14
R0490:Ptpn22 UTSW 3 103886179 missense probably damaging 1.00
R0494:Ptpn22 UTSW 3 103860455 missense probably damaging 1.00
R0626:Ptpn22 UTSW 3 103860405 start codon destroyed probably null 1.00
R0743:Ptpn22 UTSW 3 103902171 missense probably damaging 1.00
R1441:Ptpn22 UTSW 3 103874247 missense probably damaging 1.00
R1610:Ptpn22 UTSW 3 103902196 splice site probably null
R1698:Ptpn22 UTSW 3 103885798 missense probably benign 0.20
R1785:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1786:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1919:Ptpn22 UTSW 3 103876738 critical splice donor site probably null
R2045:Ptpn22 UTSW 3 103874021 missense possibly damaging 0.61
R3977:Ptpn22 UTSW 3 103873641 splice site probably benign
R4176:Ptpn22 UTSW 3 103886245 missense probably benign 0.00
R4478:Ptpn22 UTSW 3 103902064 intron probably benign
R5093:Ptpn22 UTSW 3 103882102 missense probably benign 0.39
R5579:Ptpn22 UTSW 3 103882139 splice site probably null
R6022:Ptpn22 UTSW 3 103886105 missense probably benign 0.00
R6110:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R6387:Ptpn22 UTSW 3 103885386 missense probably benign 0.18
R7335:Ptpn22 UTSW 3 103886019 missense probably damaging 0.97
R7516:Ptpn22 UTSW 3 103885538 missense probably benign 0.16
R7523:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R7583:Ptpn22 UTSW 3 103902114 missense probably benign 0.11
R8141:Ptpn22 UTSW 3 103886327 missense possibly damaging 0.67
Z1177:Ptpn22 UTSW 3 103885700 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTGAAGAACAATTAGCCCTTTTCAG -3'
(R):5'- TAAAGGACCTTGCCCTTACTTTGC -3'

Sequencing Primer
(F):5'- AGATCACTGTAAGAGTTAAGGGTTCC -3'
(R):5'- CTTACTTTGCCCATGACAGAAC -3'
Posted On2020-06-30