Mutagenetix > Incidental Mutation

Incidental Mutation 'R8129:Large1'

631908

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

067558-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.654) question?

Stock #

R8129 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72815957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 713 (D713G)

Ref Sequence

ENSEMBL: ENSMUSP00000004497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: D713G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: D713G

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: D713G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: D713G

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: D713G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.0%
20x: 85.2%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	C	2: 35,376,175	D161G	probably damaging	Het
Adamts19	T	C	18: 59,007,487		probably null	Het
Ahnak	A	T	19: 9,000,100	M1L	not run	Het
Appl1	A	G	14: 26,949,509	S329P	possibly damaging	Het
Bach1	C	T	16: 87,722,426	R535W	possibly damaging	Het
Bicc1	T	C	10: 71,079,203	D77G	probably benign	Het
Bub1b	T	A	2: 118,638,494	D913E	probably benign	Het
Cdhr2	G	T	13: 54,716,395		probably null	Het
Col25a1	T	C	3: 130,496,401	S247P	probably damaging	Het
Commd8	T	C	5: 72,162,821	M126V	unknown	Het
Dpysl4	C	T	7: 139,086,160	T13M	probably benign	Het
Epc1	A	G	18: 6,439,634	V776A	possibly damaging	Het
Fancg	G	T	4: 43,005,036		probably null	Het
Fdx1	T	C	9: 51,948,626	T135A	probably benign	Het
Fgf7	T	C	2: 126,035,845	V44A	probably benign	Het
Fgfr3	A	T	5: 33,733,906	M523L	probably damaging	Het
Focad	A	T	4: 88,232,763	H548L	unknown	Het
Ftsj3	C	A	11: 106,253,831	V111F	probably benign	Het
Gm28168	T	A	1: 117,929,753	D12E	probably damaging	Het
Gprin3	T	C	6: 59,353,859	T488A	probably benign	Het
Hormad2	C	A	11: 4,346,648	V279L	probably benign	Het
Hs6st1	A	G	1: 36,069,024	K123E	probably damaging	Het
Ice1	A	G	13: 70,606,201	S589P	probably benign	Het
Il1r1	T	A	1: 40,302,287	H286Q	probably benign	Het
Il1rl1	T	A	1: 40,451,827	C423S	probably damaging	Het
L1td1	A	T	4: 98,733,326	M42L	probably benign	Het
Llgl2	C	A	11: 115,850,911		probably null	Het
Lrp2	C	T	2: 69,430,280	V4536M	possibly damaging	Het
Map3k19	A	C	1: 127,822,683	L977R	possibly damaging	Het
Myo15	A	T	11: 60,508,200	D1617V		Het
Nek3	A	G	8: 22,149,892	I189T	probably damaging	Het
Nrap	C	T	19: 56,366,636		probably null	Het
Olfr1249	C	A	2: 89,630,448	G150V	probably damaging	Het
Olfr1375	G	A	11: 51,048,383	R92K	probably benign	Het
Olfr1474	A	T	19: 13,471,144	Y16F	probably damaging	Het
Olfr652	A	G	7: 104,564,377	Y52C	probably benign	Het
Omd	A	C	13: 49,592,089	D325A	probably damaging	Het
Pabpc6	C	T	17: 9,668,498	V375I	possibly damaging	Het
Pcdha5	A	G	18: 36,961,779	D447G	probably damaging	Het
Pla2r1	A	T	2: 60,432,600	W1032R	probably damaging	Het
Ppp2r5d	T	C	17: 46,684,337	Y524C	probably benign	Het
Ppp4r3b	T	C	11: 29,209,364	Y573H	probably damaging	Het
Prune2	T	C	19: 17,118,836	I568T	probably benign	Het
Ptpn22	G	A	3: 103,890,284		probably null	Het
Rbm12b1	A	G	4: 12,145,549	D507G	probably damaging	Het
Rdh7	A	G	10: 127,887,501	S162P	probably benign	Het
Rreb1	C	T	13: 37,929,799	A378V	probably benign	Het
Scaf11	A	G	15: 96,419,469	F738S	probably damaging	Het
Sdk1	C	A	5: 142,191,893	N2031K	probably benign	Het
Serpina3c	A	T	12: 104,151,797	L94Q	probably damaging	Het
Sgo2b	T	C	8: 63,928,800	S333G	possibly damaging	Het
Slc22a15	A	G	3: 101,915,342	V88A	possibly damaging	Het
Smarcad1	G	T	6: 65,067,094	D217Y	probably benign	Het
Sppl2a	A	G	2: 126,923,470	F244S	probably damaging	Het
Sspo	G	A	6: 48,467,025	D2156N	possibly damaging	Het
Taf2	G	A	15: 55,059,988	R298C	probably damaging	Het
Tap2	C	T	17: 34,205,698	T135I	probably benign	Het
Tbx15	G	T	3: 99,253,938	V20F	probably damaging	Het
Tes	A	T	6: 17,065,243		probably benign	Het
Tmem39b	A	T	4: 129,678,675	M378K	probably damaging	Het
Trim44	A	G	2: 102,400,503	V61A	unknown	Het
Ttll5	T	C	12: 85,891,084		probably null	Het
Tubgcp4	C	T	2: 121,173,628	T50I	possibly damaging	Het
Txndc17	G	A	11: 72,207,762	V47M	probably damaging	Het
Ubp1	A	G	9: 113,975,349	E494G	possibly damaging	Het
Utp20	A	T	10: 88,792,625	S936T	probably benign	Het
Wdr64	A	G	1: 175,775,588	D585G	probably damaging	Het
Wdtc1	A	T	4: 133,304,149		probably null	Het
Zfp292	A	G	4: 34,807,386	M1891T	probably damaging	Het
Zfp84	A	C	7: 29,776,437	I185L	probably benign	Het
Zmym4	A	G	4: 126,915,163	F364L	possibly damaging	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
R9653:Large1	UTSW	8	72837478	missense	probably benign
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAAAGCAGTGTTGGCTTTTGTC -3'
(R):5'- AGCTATTGTGGCCTTTCCTG -3'

Sequencing Primer
(F):5'- CCCAGCAGGAAGTGGTTC -3'
(R):5'- GTGGCCTTTCCTGGTGTTATTCTC -3'

Posted On

2020-06-30