Incidental Mutation 'R8129:Ice1'
ID 631926
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 067558-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R8129 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70754320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 589 (S589P)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably benign
Transcript: ENSMUST00000043493
AA Change: S589P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: S589P

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 85.2%
Validation Efficiency 98% (99/101)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,266,187 (GRCm39) D161G probably damaging Het
Adamts19 T C 18: 59,140,559 (GRCm39) probably null Het
Ahnak A T 19: 8,977,464 (GRCm39) M1L not run Het
Appl1 A G 14: 26,671,466 (GRCm39) S329P possibly damaging Het
Bach1 C T 16: 87,519,314 (GRCm39) R535W possibly damaging Het
Bicc1 T C 10: 70,915,033 (GRCm39) D77G probably benign Het
Bub1b T A 2: 118,468,975 (GRCm39) D913E probably benign Het
Cdhr2 G T 13: 54,864,208 (GRCm39) probably null Het
Col25a1 T C 3: 130,290,050 (GRCm39) S247P probably damaging Het
Commd8 T C 5: 72,320,164 (GRCm39) M126V unknown Het
Dpysl4 C T 7: 138,666,076 (GRCm39) T13M probably benign Het
Epc1 A G 18: 6,439,634 (GRCm39) V776A possibly damaging Het
Fancg G T 4: 43,005,036 (GRCm39) probably null Het
Fdx1 T C 9: 51,859,926 (GRCm39) T135A probably benign Het
Fgf7 T C 2: 125,877,765 (GRCm39) V44A probably benign Het
Fgfr3 A T 5: 33,891,250 (GRCm39) M523L probably damaging Het
Focad A T 4: 88,151,000 (GRCm39) H548L unknown Het
Ftsj3 C A 11: 106,144,657 (GRCm39) V111F probably benign Het
Gm28168 T A 1: 117,857,483 (GRCm39) D12E probably damaging Het
Gprin3 T C 6: 59,330,844 (GRCm39) T488A probably benign Het
Hormad2 C A 11: 4,296,648 (GRCm39) V279L probably benign Het
Hs6st1 A G 1: 36,108,105 (GRCm39) K123E probably damaging Het
Il1r1 T A 1: 40,341,447 (GRCm39) H286Q probably benign Het
Il1rl1 T A 1: 40,490,987 (GRCm39) C423S probably damaging Het
L1td1 A T 4: 98,621,563 (GRCm39) M42L probably benign Het
Large1 T C 8: 73,542,585 (GRCm39) D713G probably damaging Het
Llgl2 C A 11: 115,741,737 (GRCm39) probably null Het
Lrp2 C T 2: 69,260,624 (GRCm39) V4536M possibly damaging Het
Map3k19 A C 1: 127,750,420 (GRCm39) L977R possibly damaging Het
Myo15a A T 11: 60,399,026 (GRCm39) D1617V Het
Nek3 A G 8: 22,639,908 (GRCm39) I189T probably damaging Het
Nrap C T 19: 56,355,068 (GRCm39) probably null Het
Omd A C 13: 49,745,565 (GRCm39) D325A probably damaging Het
Or1x6 G A 11: 50,939,210 (GRCm39) R92K probably benign Het
Or4a76 C A 2: 89,460,792 (GRCm39) G150V probably damaging Het
Or52h7 A G 7: 104,213,584 (GRCm39) Y52C probably benign Het
Or5b118 A T 19: 13,448,508 (GRCm39) Y16F probably damaging Het
Pabpc6 C T 17: 9,887,427 (GRCm39) V375I possibly damaging Het
Pcdha5 A G 18: 37,094,832 (GRCm39) D447G probably damaging Het
Pla2r1 A T 2: 60,262,944 (GRCm39) W1032R probably damaging Het
Ppp2r5d T C 17: 46,995,263 (GRCm39) Y524C probably benign Het
Ppp4r3b T C 11: 29,159,364 (GRCm39) Y573H probably damaging Het
Prune2 T C 19: 17,096,200 (GRCm39) I568T probably benign Het
Ptpn22 G A 3: 103,797,600 (GRCm39) probably null Het
Rbm12b1 A G 4: 12,145,549 (GRCm39) D507G probably damaging Het
Rdh7 A G 10: 127,723,370 (GRCm39) S162P probably benign Het
Rreb1 C T 13: 38,113,775 (GRCm39) A378V probably benign Het
Scaf11 A G 15: 96,317,350 (GRCm39) F738S probably damaging Het
Sdk1 C A 5: 142,177,648 (GRCm39) N2031K probably benign Het
Serpina3c A T 12: 104,118,056 (GRCm39) L94Q probably damaging Het
Sgo2b T C 8: 64,381,834 (GRCm39) S333G possibly damaging Het
Slc22a15 A G 3: 101,822,658 (GRCm39) V88A possibly damaging Het
Smarcad1 G T 6: 65,044,078 (GRCm39) D217Y probably benign Het
Sppl2a A G 2: 126,765,390 (GRCm39) F244S probably damaging Het
Sspo G A 6: 48,443,959 (GRCm39) D2156N possibly damaging Het
Taf2 G A 15: 54,923,384 (GRCm39) R298C probably damaging Het
Tap2 C T 17: 34,424,672 (GRCm39) T135I probably benign Het
Tbx15 G T 3: 99,161,254 (GRCm39) V20F probably damaging Het
Tes A T 6: 17,065,242 (GRCm39) probably benign Het
Tmem39b A T 4: 129,572,468 (GRCm39) M378K probably damaging Het
Trim44 A G 2: 102,230,848 (GRCm39) V61A unknown Het
Ttll5 T C 12: 85,937,858 (GRCm39) probably null Het
Tubgcp4 C T 2: 121,004,109 (GRCm39) T50I possibly damaging Het
Txndc17 G A 11: 72,098,588 (GRCm39) V47M probably damaging Het
Ubp1 A G 9: 113,804,417 (GRCm39) E494G possibly damaging Het
Utp20 A T 10: 88,628,487 (GRCm39) S936T probably benign Het
Wdr64 A G 1: 175,603,154 (GRCm39) D585G probably damaging Het
Wdtc1 A T 4: 133,031,460 (GRCm39) probably null Het
Zfp292 A G 4: 34,807,386 (GRCm39) M1891T probably damaging Het
Zfp84 A C 7: 29,475,862 (GRCm39) I185L probably benign Het
Zmym4 A G 4: 126,808,956 (GRCm39) F364L possibly damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1525:Ice1 UTSW 13 70,753,529 (GRCm39) missense probably benign 0.01
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70,752,672 (GRCm39) missense probably damaging 1.00
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1898:Ice1 UTSW 13 70,750,426 (GRCm39) missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2909:Ice1 UTSW 13 70,744,292 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R5914:Ice1 UTSW 13 70,754,496 (GRCm39) missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6853:Ice1 UTSW 13 70,751,421 (GRCm39) missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7812:Ice1 UTSW 13 70,751,124 (GRCm39) missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCTGTTGGCTCAGACC -3'
(R):5'- GCAAGAGGACCTTCAGTGAACTC -3'

Sequencing Primer
(F):5'- TGTTGGCTCAGACCGCAGAAG -3'
(R):5'- GGACCTTCAGTGAACTCATAGAATC -3'
Posted On 2020-06-30