Incidental Mutation 'R8129:Ice1'
ID631926
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R8129 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70606201 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 589 (S589P)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect probably benign
Transcript: ENSMUST00000043493
AA Change: S589P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: S589P

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 85.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,175 D161G probably damaging Het
Adamts19 T C 18: 59,007,487 probably null Het
Ahnak A T 19: 9,000,100 M1L not run Het
Appl1 A G 14: 26,949,509 S329P possibly damaging Het
Bach1 C T 16: 87,722,426 R535W possibly damaging Het
Bicc1 T C 10: 71,079,203 D77G probably benign Het
Bub1b T A 2: 118,638,494 D913E probably benign Het
Col25a1 T C 3: 130,496,401 S247P probably damaging Het
Ctnnd2 A T 15: 31,027,632 E1234V probably damaging Het
Dpysl4 C T 7: 139,086,160 T13M probably benign Het
Epc1 A G 18: 6,439,634 V776A possibly damaging Het
Fdx1 T C 9: 51,948,626 T135A probably benign Het
Fgf7 T C 2: 126,035,845 V44A probably benign Het
Fgfr3 A T 5: 33,733,906 M523L probably damaging Het
Focad A T 4: 88,232,763 H548L unknown Het
Ftsj3 C A 11: 106,253,831 V111F probably benign Het
Gm28168 T A 1: 117,929,753 D12E probably damaging Het
Gprin3 T C 6: 59,353,859 T488A probably benign Het
Hormad2 C A 11: 4,346,648 V279L probably benign Het
Hs6st1 A G 1: 36,069,024 K123E probably damaging Het
Il1r1 T A 1: 40,302,287 H286Q probably benign Het
Il1rl1 T A 1: 40,451,827 C423S probably damaging Het
L1td1 A T 4: 98,733,326 M42L probably benign Het
Large1 T C 8: 72,815,957 D713G probably damaging Het
Lrp2 C T 2: 69,430,280 V4536M possibly damaging Het
Map3k19 A C 1: 127,822,683 L977R possibly damaging Het
Mier2 C A 10: 79,542,655 D350Y probably damaging Het
Myo15 A T 11: 60,508,200 D1617V Het
Nek3 A G 8: 22,149,892 I189T probably damaging Het
Olfr1249 C A 2: 89,630,448 G150V probably damaging Het
Olfr1338 C T 4: 118,753,998 C182Y probably damaging Het
Olfr1375 G A 11: 51,048,383 R92K probably benign Het
Olfr1474 A T 19: 13,471,144 Y16F probably damaging Het
Olfr652 A G 7: 104,564,377 Y52C probably benign Het
Omd A C 13: 49,592,089 D325A probably damaging Het
Pabpc6 C T 17: 9,668,498 V375I possibly damaging Het
Pcdha5 A G 18: 36,961,779 D447G probably damaging Het
Pla2r1 A T 2: 60,432,600 W1032R probably damaging Het
Plekhh1 C T 12: 79,073,438 L1017F probably damaging Het
Ppp2r5d T C 17: 46,684,337 Y524C probably benign Het
Ppp4r3b T C 11: 29,209,364 Y573H probably damaging Het
Prune2 T C 19: 17,118,836 I568T probably benign Het
Ptpn22 G A 3: 103,890,284 probably null Het
Rbm12b1 A G 4: 12,145,549 D507G probably damaging Het
Rdh7 A G 10: 127,887,501 S162P probably benign Het
Rreb1 C T 13: 37,929,799 A378V probably benign Het
Scaf11 A G 15: 96,419,469 F738S probably damaging Het
Sdk1 C A 5: 142,191,893 N2031K probably benign Het
Serpina3c A T 12: 104,151,797 L94Q probably damaging Het
Sgo2b T C 8: 63,928,800 S333G possibly damaging Het
Slc22a15 A G 3: 101,915,342 V88A possibly damaging Het
Smarcad1 G T 6: 65,067,094 D217Y probably benign Het
Sppl2a A G 2: 126,923,470 F244S probably damaging Het
Sspo G A 6: 48,467,025 D2156N possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tap2 C T 17: 34,205,698 T135I probably benign Het
Tbx15 G T 3: 99,253,938 V20F probably damaging Het
Tmem39b A T 4: 129,678,675 M378K probably damaging Het
Trim44 A G 2: 102,400,503 V61A unknown Het
Ttll5 T C 12: 85,891,084 probably null Het
Tubgcp4 C T 2: 121,173,628 T50I possibly damaging Het
Txndc17 G A 11: 72,207,762 V47M probably damaging Het
Ubp1 A G 9: 113,975,349 E494G possibly damaging Het
Utp20 A T 10: 88,792,625 S936T probably benign Het
Wdr64 A G 1: 175,775,588 D585G probably damaging Het
Wdtc1 A T 4: 133,304,149 probably null Het
Zfp292 A G 4: 34,807,386 M1891T probably damaging Het
Zfp84 A C 7: 29,776,437 I185L probably benign Het
Zmym4 A G 4: 126,915,163 F364L possibly damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCTGTTGGCTCAGACC -3'
(R):5'- GCAAGAGGACCTTCAGTGAACTC -3'

Sequencing Primer
(F):5'- TGTTGGCTCAGACCGCAGAAG -3'
(R):5'- GGACCTTCAGTGAACTCATAGAATC -3'
Posted On2020-06-30