Incidental Mutation 'R8129:Appl1'
ID631927
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R8129 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26949509 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 329 (S329P)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036570
AA Change: S329P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: S329P

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 85.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,175 D161G probably damaging Het
Adamts19 T C 18: 59,007,487 probably null Het
Ahnak A T 19: 9,000,100 M1L not run Het
Bach1 C T 16: 87,722,426 R535W possibly damaging Het
Bicc1 T C 10: 71,079,203 D77G probably benign Het
Bub1b T A 2: 118,638,494 D913E probably benign Het
Col25a1 T C 3: 130,496,401 S247P probably damaging Het
Ctnnd2 A T 15: 31,027,632 E1234V probably damaging Het
Dpysl4 C T 7: 139,086,160 T13M probably benign Het
Epc1 A G 18: 6,439,634 V776A possibly damaging Het
Fdx1 T C 9: 51,948,626 T135A probably benign Het
Fgf7 T C 2: 126,035,845 V44A probably benign Het
Fgfr3 A T 5: 33,733,906 M523L probably damaging Het
Focad A T 4: 88,232,763 H548L unknown Het
Ftsj3 C A 11: 106,253,831 V111F probably benign Het
Gm28168 T A 1: 117,929,753 D12E probably damaging Het
Gprin3 T C 6: 59,353,859 T488A probably benign Het
Hormad2 C A 11: 4,346,648 V279L probably benign Het
Hs6st1 A G 1: 36,069,024 K123E probably damaging Het
Ice1 A G 13: 70,606,201 S589P probably benign Het
Il1r1 T A 1: 40,302,287 H286Q probably benign Het
Il1rl1 T A 1: 40,451,827 C423S probably damaging Het
L1td1 A T 4: 98,733,326 M42L probably benign Het
Large1 T C 8: 72,815,957 D713G probably damaging Het
Lrp2 C T 2: 69,430,280 V4536M possibly damaging Het
Map3k19 A C 1: 127,822,683 L977R possibly damaging Het
Mier2 C A 10: 79,542,655 D350Y probably damaging Het
Myo15 A T 11: 60,508,200 D1617V Het
Nek3 A G 8: 22,149,892 I189T probably damaging Het
Olfr1249 C A 2: 89,630,448 G150V probably damaging Het
Olfr1338 C T 4: 118,753,998 C182Y probably damaging Het
Olfr1375 G A 11: 51,048,383 R92K probably benign Het
Olfr1474 A T 19: 13,471,144 Y16F probably damaging Het
Olfr652 A G 7: 104,564,377 Y52C probably benign Het
Omd A C 13: 49,592,089 D325A probably damaging Het
Pabpc6 C T 17: 9,668,498 V375I possibly damaging Het
Pcdha5 A G 18: 36,961,779 D447G probably damaging Het
Pla2r1 A T 2: 60,432,600 W1032R probably damaging Het
Plekhh1 C T 12: 79,073,438 L1017F probably damaging Het
Ppp2r5d T C 17: 46,684,337 Y524C probably benign Het
Ppp4r3b T C 11: 29,209,364 Y573H probably damaging Het
Prune2 T C 19: 17,118,836 I568T probably benign Het
Ptpn22 G A 3: 103,890,284 probably null Het
Rbm12b1 A G 4: 12,145,549 D507G probably damaging Het
Rdh7 A G 10: 127,887,501 S162P probably benign Het
Rreb1 C T 13: 37,929,799 A378V probably benign Het
Scaf11 A G 15: 96,419,469 F738S probably damaging Het
Sdk1 C A 5: 142,191,893 N2031K probably benign Het
Serpina3c A T 12: 104,151,797 L94Q probably damaging Het
Sgo2b T C 8: 63,928,800 S333G possibly damaging Het
Slc22a15 A G 3: 101,915,342 V88A possibly damaging Het
Smarcad1 G T 6: 65,067,094 D217Y probably benign Het
Sppl2a A G 2: 126,923,470 F244S probably damaging Het
Sspo G A 6: 48,467,025 D2156N possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tap2 C T 17: 34,205,698 T135I probably benign Het
Tbx15 G T 3: 99,253,938 V20F probably damaging Het
Tmem39b A T 4: 129,678,675 M378K probably damaging Het
Trim44 A G 2: 102,400,503 V61A unknown Het
Ttll5 T C 12: 85,891,084 probably null Het
Tubgcp4 C T 2: 121,173,628 T50I possibly damaging Het
Txndc17 G A 11: 72,207,762 V47M probably damaging Het
Ubp1 A G 9: 113,975,349 E494G possibly damaging Het
Utp20 A T 10: 88,792,625 S936T probably benign Het
Wdr64 A G 1: 175,775,588 D585G probably damaging Het
Wdtc1 A T 4: 133,304,149 probably null Het
Zfp292 A G 4: 34,807,386 M1891T probably damaging Het
Zfp84 A C 7: 29,776,437 I185L probably benign Het
Zmym4 A G 4: 126,915,163 F364L possibly damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGACACATGTGAAGGCAATAC -3'
(R):5'- TGGTGCCTTTCTGCAAGTCG -3'

Sequencing Primer
(F):5'- AATGTATGTCTTATTTAGCAGC -3'
(R):5'- GCAAGTCGTTTTGTTTTCACATGC -3'
Posted On2020-06-30