Mutagenetix > Incidental Mutation

Incidental Mutation 'R8129:Taf2'

631929

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8129 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55059988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 298 (R298C)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041733
AA Change: R298C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: R298C

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.0%
20x: 85.2%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	C	2: 35,376,175	D161G	probably damaging	Het
Adamts19	T	C	18: 59,007,487		probably null	Het
Ahnak	A	T	19: 9,000,100	M1L	not run	Het
Appl1	A	G	14: 26,949,509	S329P	possibly damaging	Het
Bach1	C	T	16: 87,722,426	R535W	possibly damaging	Het
Bicc1	T	C	10: 71,079,203	D77G	probably benign	Het
Bub1b	T	A	2: 118,638,494	D913E	probably benign	Het
Cdhr2	G	T	13: 54,716,395		probably null	Het
Col25a1	T	C	3: 130,496,401	S247P	probably damaging	Het
Commd8	T	C	5: 72,162,821	M126V	unknown	Het
Dpysl4	C	T	7: 139,086,160	T13M	probably benign	Het
Epc1	A	G	18: 6,439,634	V776A	possibly damaging	Het
Fancg	G	T	4: 43,005,036		probably null	Het
Fdx1	T	C	9: 51,948,626	T135A	probably benign	Het
Fgf7	T	C	2: 126,035,845	V44A	probably benign	Het
Fgfr3	A	T	5: 33,733,906	M523L	probably damaging	Het
Focad	A	T	4: 88,232,763	H548L	unknown	Het
Ftsj3	C	A	11: 106,253,831	V111F	probably benign	Het
Gm28168	T	A	1: 117,929,753	D12E	probably damaging	Het
Gprin3	T	C	6: 59,353,859	T488A	probably benign	Het
Hormad2	C	A	11: 4,346,648	V279L	probably benign	Het
Hs6st1	A	G	1: 36,069,024	K123E	probably damaging	Het
Ice1	A	G	13: 70,606,201	S589P	probably benign	Het
Il1r1	T	A	1: 40,302,287	H286Q	probably benign	Het
Il1rl1	T	A	1: 40,451,827	C423S	probably damaging	Het
L1td1	A	T	4: 98,733,326	M42L	probably benign	Het
Large1	T	C	8: 72,815,957	D713G	probably damaging	Het
Llgl2	C	A	11: 115,850,911		probably null	Het
Lrp2	C	T	2: 69,430,280	V4536M	possibly damaging	Het
Map3k19	A	C	1: 127,822,683	L977R	possibly damaging	Het
Myo15	A	T	11: 60,508,200	D1617V		Het
Nek3	A	G	8: 22,149,892	I189T	probably damaging	Het
Nrap	C	T	19: 56,366,636		probably null	Het
Olfr1249	C	A	2: 89,630,448	G150V	probably damaging	Het
Olfr1375	G	A	11: 51,048,383	R92K	probably benign	Het
Olfr1474	A	T	19: 13,471,144	Y16F	probably damaging	Het
Olfr652	A	G	7: 104,564,377	Y52C	probably benign	Het
Omd	A	C	13: 49,592,089	D325A	probably damaging	Het
Pabpc6	C	T	17: 9,668,498	V375I	possibly damaging	Het
Pcdha5	A	G	18: 36,961,779	D447G	probably damaging	Het
Pla2r1	A	T	2: 60,432,600	W1032R	probably damaging	Het
Ppp2r5d	T	C	17: 46,684,337	Y524C	probably benign	Het
Ppp4r3b	T	C	11: 29,209,364	Y573H	probably damaging	Het
Prune2	T	C	19: 17,118,836	I568T	probably benign	Het
Ptpn22	G	A	3: 103,890,284		probably null	Het
Rbm12b1	A	G	4: 12,145,549	D507G	probably damaging	Het
Rdh7	A	G	10: 127,887,501	S162P	probably benign	Het
Rreb1	C	T	13: 37,929,799	A378V	probably benign	Het
Scaf11	A	G	15: 96,419,469	F738S	probably damaging	Het
Sdk1	C	A	5: 142,191,893	N2031K	probably benign	Het
Serpina3c	A	T	12: 104,151,797	L94Q	probably damaging	Het
Sgo2b	T	C	8: 63,928,800	S333G	possibly damaging	Het
Slc22a15	A	G	3: 101,915,342	V88A	possibly damaging	Het
Smarcad1	G	T	6: 65,067,094	D217Y	probably benign	Het
Sppl2a	A	G	2: 126,923,470	F244S	probably damaging	Het
Sspo	G	A	6: 48,467,025	D2156N	possibly damaging	Het
Tap2	C	T	17: 34,205,698	T135I	probably benign	Het
Tbx15	G	T	3: 99,253,938	V20F	probably damaging	Het
Tes	A	T	6: 17,065,243		probably benign	Het
Tmem39b	A	T	4: 129,678,675	M378K	probably damaging	Het
Trim44	A	G	2: 102,400,503	V61A	unknown	Het
Ttll5	T	C	12: 85,891,084		probably null	Het
Tubgcp4	C	T	2: 121,173,628	T50I	possibly damaging	Het
Txndc17	G	A	11: 72,207,762	V47M	probably damaging	Het
Ubp1	A	G	9: 113,975,349	E494G	possibly damaging	Het
Utp20	A	T	10: 88,792,625	S936T	probably benign	Het
Wdr64	A	G	1: 175,775,588	D585G	probably damaging	Het
Wdtc1	A	T	4: 133,304,149		probably null	Het
Zfp292	A	G	4: 34,807,386	M1891T	probably damaging	Het
Zfp84	A	C	7: 29,776,437	I185L	probably benign	Het
Zmym4	A	G	4: 126,915,163	F364L	possibly damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTTATGTAAGAGGCTACACTGTAAC -3'
(R):5'- TGTAAACCTGATCTGAAAAGCCTAC -3'

Sequencing Primer
(F):5'- TACATGATGCTCAAAGCCAGTCTC -3'
(R):5'- GAAAAGCCTACTAATTTTACAACAGC -3'

Posted On

2020-06-30