Mutagenetix > Incidental Mutation

Incidental Mutation 'R8129:Adamts19'

631937

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8129 (G1)

Quality Score

181.009

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 59007487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably null
Transcript: ENSMUST00000052907

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.0%
20x: 85.2%

Validation Efficiency

98% (99/101)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	C	2: 35,376,175	D161G	probably damaging	Het
Ahnak	A	T	19: 9,000,100	M1L	not run	Het
Appl1	A	G	14: 26,949,509	S329P	possibly damaging	Het
Bach1	C	T	16: 87,722,426	R535W	possibly damaging	Het
Bicc1	T	C	10: 71,079,203	D77G	probably benign	Het
Bub1b	T	A	2: 118,638,494	D913E	probably benign	Het
Cdhr2	G	T	13: 54,716,395		probably null	Het
Col25a1	T	C	3: 130,496,401	S247P	probably damaging	Het
Commd8	T	C	5: 72,162,821	M126V	unknown	Het
Dpysl4	C	T	7: 139,086,160	T13M	probably benign	Het
Epc1	A	G	18: 6,439,634	V776A	possibly damaging	Het
Fancg	G	T	4: 43,005,036		probably null	Het
Fdx1	T	C	9: 51,948,626	T135A	probably benign	Het
Fgf7	T	C	2: 126,035,845	V44A	probably benign	Het
Fgfr3	A	T	5: 33,733,906	M523L	probably damaging	Het
Focad	A	T	4: 88,232,763	H548L	unknown	Het
Ftsj3	C	A	11: 106,253,831	V111F	probably benign	Het
Gm28168	T	A	1: 117,929,753	D12E	probably damaging	Het
Gprin3	T	C	6: 59,353,859	T488A	probably benign	Het
Hormad2	C	A	11: 4,346,648	V279L	probably benign	Het
Hs6st1	A	G	1: 36,069,024	K123E	probably damaging	Het
Ice1	A	G	13: 70,606,201	S589P	probably benign	Het
Il1r1	T	A	1: 40,302,287	H286Q	probably benign	Het
Il1rl1	T	A	1: 40,451,827	C423S	probably damaging	Het
L1td1	A	T	4: 98,733,326	M42L	probably benign	Het
Large1	T	C	8: 72,815,957	D713G	probably damaging	Het
Llgl2	C	A	11: 115,850,911		probably null	Het
Lrp2	C	T	2: 69,430,280	V4536M	possibly damaging	Het
Map3k19	A	C	1: 127,822,683	L977R	possibly damaging	Het
Myo15	A	T	11: 60,508,200	D1617V		Het
Nek3	A	G	8: 22,149,892	I189T	probably damaging	Het
Nrap	C	T	19: 56,366,636		probably null	Het
Olfr1249	C	A	2: 89,630,448	G150V	probably damaging	Het
Olfr1375	G	A	11: 51,048,383	R92K	probably benign	Het
Olfr1474	A	T	19: 13,471,144	Y16F	probably damaging	Het
Olfr652	A	G	7: 104,564,377	Y52C	probably benign	Het
Omd	A	C	13: 49,592,089	D325A	probably damaging	Het
Pabpc6	C	T	17: 9,668,498	V375I	possibly damaging	Het
Pcdha5	A	G	18: 36,961,779	D447G	probably damaging	Het
Pla2r1	A	T	2: 60,432,600	W1032R	probably damaging	Het
Ppp2r5d	T	C	17: 46,684,337	Y524C	probably benign	Het
Ppp4r3b	T	C	11: 29,209,364	Y573H	probably damaging	Het
Prune2	T	C	19: 17,118,836	I568T	probably benign	Het
Ptpn22	G	A	3: 103,890,284		probably null	Het
Rbm12b1	A	G	4: 12,145,549	D507G	probably damaging	Het
Rdh7	A	G	10: 127,887,501	S162P	probably benign	Het
Rreb1	C	T	13: 37,929,799	A378V	probably benign	Het
Scaf11	A	G	15: 96,419,469	F738S	probably damaging	Het
Sdk1	C	A	5: 142,191,893	N2031K	probably benign	Het
Serpina3c	A	T	12: 104,151,797	L94Q	probably damaging	Het
Sgo2b	T	C	8: 63,928,800	S333G	possibly damaging	Het
Slc22a15	A	G	3: 101,915,342	V88A	possibly damaging	Het
Smarcad1	G	T	6: 65,067,094	D217Y	probably benign	Het
Sppl2a	A	G	2: 126,923,470	F244S	probably damaging	Het
Sspo	G	A	6: 48,467,025	D2156N	possibly damaging	Het
Taf2	G	A	15: 55,059,988	R298C	probably damaging	Het
Tap2	C	T	17: 34,205,698	T135I	probably benign	Het
Tbx15	G	T	3: 99,253,938	V20F	probably damaging	Het
Tes	A	T	6: 17,065,243		probably benign	Het
Tmem39b	A	T	4: 129,678,675	M378K	probably damaging	Het
Trim44	A	G	2: 102,400,503	V61A	unknown	Het
Ttll5	T	C	12: 85,891,084		probably null	Het
Tubgcp4	C	T	2: 121,173,628	T50I	possibly damaging	Het
Txndc17	G	A	11: 72,207,762	V47M	probably damaging	Het
Ubp1	A	G	9: 113,975,349	E494G	possibly damaging	Het
Utp20	A	T	10: 88,792,625	S936T	probably benign	Het
Wdr64	A	G	1: 175,775,588	D585G	probably damaging	Het
Wdtc1	A	T	4: 133,304,149		probably null	Het
Zfp292	A	G	4: 34,807,386	M1891T	probably damaging	Het
Zfp84	A	C	7: 29,776,437	I185L	probably benign	Het
Zmym4	A	G	4: 126,915,163	F364L	possibly damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TTGCATCGGAGTTTGAAGACAC -3'
(R):5'- ACTCTATCAAAGGCATCTTCTACAG -3'

Sequencing Primer
(F):5'- ATGTTACTCATCGGCGGC -3'
(R):5'- GGCATCTTCTACAGACACAGATGAG -3'

Posted On

2020-06-30