Incidental Mutation 'R8129:Prune2'
ID 631940
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, A330102H22Rik, 6330414G02Rik, Olfaxin
MMRRC Submission 067558-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8129 (G1)
Quality Score 181.009
Status Validated
Chromosome 19
Chromosomal Location 16933482-17201296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17096200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 568 (I568T)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087689
AA Change: I568T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: I568T

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 85.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,266,187 (GRCm39) D161G probably damaging Het
Adamts19 T C 18: 59,140,559 (GRCm39) probably null Het
Ahnak A T 19: 8,977,464 (GRCm39) M1L not run Het
Appl1 A G 14: 26,671,466 (GRCm39) S329P possibly damaging Het
Bach1 C T 16: 87,519,314 (GRCm39) R535W possibly damaging Het
Bicc1 T C 10: 70,915,033 (GRCm39) D77G probably benign Het
Bub1b T A 2: 118,468,975 (GRCm39) D913E probably benign Het
Cdhr2 G T 13: 54,864,208 (GRCm39) probably null Het
Col25a1 T C 3: 130,290,050 (GRCm39) S247P probably damaging Het
Commd8 T C 5: 72,320,164 (GRCm39) M126V unknown Het
Dpysl4 C T 7: 138,666,076 (GRCm39) T13M probably benign Het
Epc1 A G 18: 6,439,634 (GRCm39) V776A possibly damaging Het
Fancg G T 4: 43,005,036 (GRCm39) probably null Het
Fdx1 T C 9: 51,859,926 (GRCm39) T135A probably benign Het
Fgf7 T C 2: 125,877,765 (GRCm39) V44A probably benign Het
Fgfr3 A T 5: 33,891,250 (GRCm39) M523L probably damaging Het
Focad A T 4: 88,151,000 (GRCm39) H548L unknown Het
Ftsj3 C A 11: 106,144,657 (GRCm39) V111F probably benign Het
Gm28168 T A 1: 117,857,483 (GRCm39) D12E probably damaging Het
Gprin3 T C 6: 59,330,844 (GRCm39) T488A probably benign Het
Hormad2 C A 11: 4,296,648 (GRCm39) V279L probably benign Het
Hs6st1 A G 1: 36,108,105 (GRCm39) K123E probably damaging Het
Ice1 A G 13: 70,754,320 (GRCm39) S589P probably benign Het
Il1r1 T A 1: 40,341,447 (GRCm39) H286Q probably benign Het
Il1rl1 T A 1: 40,490,987 (GRCm39) C423S probably damaging Het
L1td1 A T 4: 98,621,563 (GRCm39) M42L probably benign Het
Large1 T C 8: 73,542,585 (GRCm39) D713G probably damaging Het
Llgl2 C A 11: 115,741,737 (GRCm39) probably null Het
Lrp2 C T 2: 69,260,624 (GRCm39) V4536M possibly damaging Het
Map3k19 A C 1: 127,750,420 (GRCm39) L977R possibly damaging Het
Myo15a A T 11: 60,399,026 (GRCm39) D1617V Het
Nek3 A G 8: 22,639,908 (GRCm39) I189T probably damaging Het
Nrap C T 19: 56,355,068 (GRCm39) probably null Het
Omd A C 13: 49,745,565 (GRCm39) D325A probably damaging Het
Or1x6 G A 11: 50,939,210 (GRCm39) R92K probably benign Het
Or4a76 C A 2: 89,460,792 (GRCm39) G150V probably damaging Het
Or52h7 A G 7: 104,213,584 (GRCm39) Y52C probably benign Het
Or5b118 A T 19: 13,448,508 (GRCm39) Y16F probably damaging Het
Pabpc6 C T 17: 9,887,427 (GRCm39) V375I possibly damaging Het
Pcdha5 A G 18: 37,094,832 (GRCm39) D447G probably damaging Het
Pla2r1 A T 2: 60,262,944 (GRCm39) W1032R probably damaging Het
Ppp2r5d T C 17: 46,995,263 (GRCm39) Y524C probably benign Het
Ppp4r3b T C 11: 29,159,364 (GRCm39) Y573H probably damaging Het
Ptpn22 G A 3: 103,797,600 (GRCm39) probably null Het
Rbm12b1 A G 4: 12,145,549 (GRCm39) D507G probably damaging Het
Rdh7 A G 10: 127,723,370 (GRCm39) S162P probably benign Het
Rreb1 C T 13: 38,113,775 (GRCm39) A378V probably benign Het
Scaf11 A G 15: 96,317,350 (GRCm39) F738S probably damaging Het
Sdk1 C A 5: 142,177,648 (GRCm39) N2031K probably benign Het
Serpina3c A T 12: 104,118,056 (GRCm39) L94Q probably damaging Het
Sgo2b T C 8: 64,381,834 (GRCm39) S333G possibly damaging Het
Slc22a15 A G 3: 101,822,658 (GRCm39) V88A possibly damaging Het
Smarcad1 G T 6: 65,044,078 (GRCm39) D217Y probably benign Het
Sppl2a A G 2: 126,765,390 (GRCm39) F244S probably damaging Het
Sspo G A 6: 48,443,959 (GRCm39) D2156N possibly damaging Het
Taf2 G A 15: 54,923,384 (GRCm39) R298C probably damaging Het
Tap2 C T 17: 34,424,672 (GRCm39) T135I probably benign Het
Tbx15 G T 3: 99,161,254 (GRCm39) V20F probably damaging Het
Tes A T 6: 17,065,242 (GRCm39) probably benign Het
Tmem39b A T 4: 129,572,468 (GRCm39) M378K probably damaging Het
Trim44 A G 2: 102,230,848 (GRCm39) V61A unknown Het
Ttll5 T C 12: 85,937,858 (GRCm39) probably null Het
Tubgcp4 C T 2: 121,004,109 (GRCm39) T50I possibly damaging Het
Txndc17 G A 11: 72,098,588 (GRCm39) V47M probably damaging Het
Ubp1 A G 9: 113,804,417 (GRCm39) E494G possibly damaging Het
Utp20 A T 10: 88,628,487 (GRCm39) S936T probably benign Het
Wdr64 A G 1: 175,603,154 (GRCm39) D585G probably damaging Het
Wdtc1 A T 4: 133,031,460 (GRCm39) probably null Het
Zfp292 A G 4: 34,807,386 (GRCm39) M1891T probably damaging Het
Zfp84 A C 7: 29,475,862 (GRCm39) I185L probably benign Het
Zmym4 A G 4: 126,808,956 (GRCm39) F364L possibly damaging Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17,145,708 (GRCm39) critical splice donor site probably null
IGL00848:Prune2 APN 19 17,096,482 (GRCm39) missense probably damaging 1.00
IGL00862:Prune2 APN 19 17,096,713 (GRCm39) missense probably benign 0.41
IGL00915:Prune2 APN 19 16,993,617 (GRCm39) missense probably damaging 1.00
IGL01084:Prune2 APN 19 17,095,573 (GRCm39) missense probably benign 0.19
IGL01109:Prune2 APN 19 17,101,243 (GRCm39) missense probably benign 0.03
IGL01372:Prune2 APN 19 17,102,433 (GRCm39) missense probably damaging 1.00
IGL01650:Prune2 APN 19 17,145,656 (GRCm39) missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17,101,267 (GRCm39) missense possibly damaging 0.50
IGL01812:Prune2 APN 19 16,981,141 (GRCm39) missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17,096,002 (GRCm39) missense probably benign 0.00
IGL02195:Prune2 APN 19 17,096,921 (GRCm39) missense probably benign 0.00
IGL02502:Prune2 APN 19 17,101,245 (GRCm39) missense probably benign 0.00
IGL02569:Prune2 APN 19 17,156,223 (GRCm39) missense probably damaging 0.99
IGL02693:Prune2 APN 19 17,101,855 (GRCm39) missense probably benign 0.03
IGL02737:Prune2 APN 19 17,170,775 (GRCm39) nonsense probably null
IGL02794:Prune2 APN 19 17,096,725 (GRCm39) missense probably benign 0.19
IGL02985:Prune2 APN 19 16,993,723 (GRCm39) critical splice donor site probably null
IGL03349:Prune2 APN 19 17,100,710 (GRCm39) missense probably damaging 1.00
3-1:Prune2 UTSW 19 17,102,646 (GRCm39) missense probably benign 0.00
R0060:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17,099,974 (GRCm39) missense probably benign 0.00
R0277:Prune2 UTSW 19 17,098,753 (GRCm39) missense probably damaging 0.99
R0321:Prune2 UTSW 19 17,099,818 (GRCm39) missense probably benign 0.39
R0321:Prune2 UTSW 19 17,098,291 (GRCm39) missense possibly damaging 0.78
R0374:Prune2 UTSW 19 17,098,274 (GRCm39) missense probably benign 0.00
R0380:Prune2 UTSW 19 17,101,371 (GRCm39) missense probably damaging 1.00
R0396:Prune2 UTSW 19 17,100,444 (GRCm39) missense probably benign 0.35
R0408:Prune2 UTSW 19 17,099,674 (GRCm39) missense probably benign 0.00
R0421:Prune2 UTSW 19 17,100,675 (GRCm39) missense probably benign 0.02
R0480:Prune2 UTSW 19 16,984,156 (GRCm39) splice site probably benign
R0531:Prune2 UTSW 19 16,984,117 (GRCm39) missense probably damaging 1.00
R0546:Prune2 UTSW 19 16,998,030 (GRCm39) splice site probably benign
R0554:Prune2 UTSW 19 17,102,582 (GRCm39) nonsense probably null
R0659:Prune2 UTSW 19 17,100,199 (GRCm39) missense probably damaging 1.00
R0699:Prune2 UTSW 19 17,101,319 (GRCm39) missense probably damaging 1.00
R0781:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1110:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1178:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1181:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1337:Prune2 UTSW 19 17,096,971 (GRCm39) missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17,189,681 (GRCm39) missense probably benign 0.40
R1385:Prune2 UTSW 19 17,102,312 (GRCm39) missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17,098,015 (GRCm39) missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17,102,374 (GRCm39) missense probably benign 0.01
R1756:Prune2 UTSW 19 17,101,068 (GRCm39) missense probably benign 0.01
R1765:Prune2 UTSW 19 17,102,962 (GRCm39) missense probably damaging 1.00
R1782:Prune2 UTSW 19 17,099,537 (GRCm39) missense probably benign 0.00
R1817:Prune2 UTSW 19 17,099,445 (GRCm39) missense probably benign 0.00
R1838:Prune2 UTSW 19 17,177,242 (GRCm39) missense probably damaging 1.00
R1851:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1852:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1866:Prune2 UTSW 19 17,100,856 (GRCm39) missense probably damaging 1.00
R1911:Prune2 UTSW 19 17,091,038 (GRCm39) missense probably benign 0.02
R1983:Prune2 UTSW 19 16,998,006 (GRCm39) missense probably damaging 0.97
R2014:Prune2 UTSW 19 17,097,887 (GRCm39) missense probably damaging 1.00
R2066:Prune2 UTSW 19 17,098,042 (GRCm39) missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17,097,109 (GRCm39) missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17,185,602 (GRCm39) missense probably damaging 1.00
R2128:Prune2 UTSW 19 17,099,786 (GRCm39) missense probably benign 0.00
R2165:Prune2 UTSW 19 17,097,546 (GRCm39) missense probably benign 0.19
R2241:Prune2 UTSW 19 17,100,456 (GRCm39) missense probably damaging 0.96
R2278:Prune2 UTSW 19 17,095,919 (GRCm39) missense possibly damaging 0.93
R2504:Prune2 UTSW 19 16,977,400 (GRCm39) missense probably damaging 1.00
R2508:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R3055:Prune2 UTSW 19 17,102,407 (GRCm39) missense probably damaging 0.98
R3086:Prune2 UTSW 19 17,098,777 (GRCm39) missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3105:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3547:Prune2 UTSW 19 17,101,712 (GRCm39) missense probably damaging 0.96
R3702:Prune2 UTSW 19 17,156,235 (GRCm39) missense probably damaging 1.00
R3753:Prune2 UTSW 19 17,102,818 (GRCm39) missense probably benign 0.38
R3933:Prune2 UTSW 19 17,101,318 (GRCm39) missense probably damaging 1.00
R3935:Prune2 UTSW 19 17,177,150 (GRCm39) missense probably damaging 1.00
R4022:Prune2 UTSW 19 16,977,384 (GRCm39) missense probably damaging 1.00
R4042:Prune2 UTSW 19 16,981,190 (GRCm39) critical splice donor site probably null
R4164:Prune2 UTSW 19 16,981,098 (GRCm39) missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17,099,274 (GRCm39) missense probably benign 0.00
R4642:Prune2 UTSW 19 16,998,019 (GRCm39) critical splice donor site probably null
R4661:Prune2 UTSW 19 16,977,387 (GRCm39) missense probably damaging 1.00
R4666:Prune2 UTSW 19 17,097,552 (GRCm39) nonsense probably null
R4823:Prune2 UTSW 19 17,097,868 (GRCm39) missense probably damaging 1.00
R4897:Prune2 UTSW 19 17,099,219 (GRCm39) missense probably benign 0.03
R4922:Prune2 UTSW 19 17,100,116 (GRCm39) missense probably benign 0.00
R4962:Prune2 UTSW 19 17,099,637 (GRCm39) missense probably benign 0.11
R5026:Prune2 UTSW 19 17,176,506 (GRCm39) missense probably damaging 1.00
R5042:Prune2 UTSW 19 17,097,161 (GRCm39) missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17,177,274 (GRCm39) missense probably damaging 1.00
R5133:Prune2 UTSW 19 16,980,995 (GRCm39) missense probably damaging 1.00
R5184:Prune2 UTSW 19 17,193,721 (GRCm39) missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5339:Prune2 UTSW 19 17,098,236 (GRCm39) missense probably damaging 1.00
R5363:Prune2 UTSW 19 17,095,630 (GRCm39) missense probably damaging 1.00
R5382:Prune2 UTSW 19 16,981,023 (GRCm39) missense probably damaging 1.00
R5436:Prune2 UTSW 19 16,998,007 (GRCm39) missense probably damaging 1.00
R5480:Prune2 UTSW 19 17,098,311 (GRCm39) missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17,095,573 (GRCm39) missense probably benign 0.19
R5678:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5814:Prune2 UTSW 19 16,993,725 (GRCm39) splice site probably null
R5894:Prune2 UTSW 19 17,098,755 (GRCm39) missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17,096,080 (GRCm39) missense probably benign 0.35
R6207:Prune2 UTSW 19 17,095,480 (GRCm39) missense probably damaging 1.00
R6218:Prune2 UTSW 19 17,098,926 (GRCm39) missense probably benign 0.00
R6573:Prune2 UTSW 19 17,098,521 (GRCm39) missense probably damaging 1.00
R6573:Prune2 UTSW 19 17,098,522 (GRCm39) missense possibly damaging 0.61
R6734:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R6805:Prune2 UTSW 19 17,097,954 (GRCm39) missense probably benign
R6837:Prune2 UTSW 19 17,156,292 (GRCm39) missense probably damaging 1.00
R6850:Prune2 UTSW 19 17,099,552 (GRCm39) missense probably benign 0.00
R6858:Prune2 UTSW 19 17,095,470 (GRCm39) missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17,100,592 (GRCm39) missense probably damaging 1.00
R6954:Prune2 UTSW 19 16,977,385 (GRCm39) missense probably damaging 1.00
R7098:Prune2 UTSW 19 17,097,966 (GRCm39) missense probably benign 0.39
R7102:Prune2 UTSW 19 17,098,577 (GRCm39) missense probably benign 0.24
R7246:Prune2 UTSW 19 17,098,732 (GRCm39) missense probably damaging 0.99
R7284:Prune2 UTSW 19 17,097,250 (GRCm39) missense probably damaging 1.00
R7295:Prune2 UTSW 19 17,097,261 (GRCm39) missense probably benign 0.01
R7371:Prune2 UTSW 19 17,096,734 (GRCm39) missense probably benign 0.02
R7651:Prune2 UTSW 19 17,097,772 (GRCm39) missense probably damaging 1.00
R7830:Prune2 UTSW 19 17,100,038 (GRCm39) missense probably benign 0.21
R7872:Prune2 UTSW 19 17,096,798 (GRCm39) missense probably benign 0.05
R7881:Prune2 UTSW 19 17,100,393 (GRCm39) missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17,156,223 (GRCm39) missense probably damaging 0.99
R7969:Prune2 UTSW 19 17,179,034 (GRCm39) missense probably damaging 0.98
R8092:Prune2 UTSW 19 17,097,357 (GRCm39) missense probably damaging 1.00
R8110:Prune2 UTSW 19 17,098,083 (GRCm39) missense probably benign 0.22
R8115:Prune2 UTSW 19 17,101,288 (GRCm39) missense probably benign 0.02
R8169:Prune2 UTSW 19 17,102,455 (GRCm39) missense probably benign 0.10
R8171:Prune2 UTSW 19 17,097,882 (GRCm39) missense probably damaging 1.00
R8176:Prune2 UTSW 19 17,095,656 (GRCm39) missense probably damaging 1.00
R8200:Prune2 UTSW 19 17,102,337 (GRCm39) missense probably benign 0.01
R8217:Prune2 UTSW 19 17,097,480 (GRCm39) missense probably benign 0.01
R8258:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8259:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8289:Prune2 UTSW 19 17,100,373 (GRCm39) missense probably benign 0.43
R8329:Prune2 UTSW 19 17,098,629 (GRCm39) missense probably benign 0.02
R8342:Prune2 UTSW 19 17,103,027 (GRCm39) missense probably benign 0.01
R8558:Prune2 UTSW 19 17,099,602 (GRCm39) missense probably damaging 0.98
R8732:Prune2 UTSW 19 17,097,769 (GRCm39) missense probably damaging 1.00
R8743:Prune2 UTSW 19 17,096,920 (GRCm39) missense probably benign 0.22
R8769:Prune2 UTSW 19 17,100,442 (GRCm39) missense probably damaging 0.96
R8862:Prune2 UTSW 19 17,097,510 (GRCm39) missense probably benign 0.04
R8936:Prune2 UTSW 19 17,099,199 (GRCm39) missense probably benign 0.24
R9040:Prune2 UTSW 19 17,097,991 (GRCm39) missense probably damaging 1.00
R9084:Prune2 UTSW 19 17,097,741 (GRCm39) missense probably damaging 1.00
R9224:Prune2 UTSW 19 17,097,393 (GRCm39) missense probably damaging 1.00
R9273:Prune2 UTSW 19 17,095,690 (GRCm39) missense possibly damaging 0.74
R9275:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9278:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9290:Prune2 UTSW 19 17,145,691 (GRCm39) missense probably benign 0.41
R9305:Prune2 UTSW 19 17,097,625 (GRCm39) missense probably benign 0.14
R9317:Prune2 UTSW 19 17,099,034 (GRCm39) missense probably benign 0.00
R9354:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R9373:Prune2 UTSW 19 17,099,502 (GRCm39) missense probably benign
R9394:Prune2 UTSW 19 16,981,053 (GRCm39) missense probably damaging 1.00
R9405:Prune2 UTSW 19 17,193,708 (GRCm39) missense probably damaging 0.99
R9476:Prune2 UTSW 19 17,096,706 (GRCm39) missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17,099,794 (GRCm39) missense probably benign 0.00
X0019:Prune2 UTSW 19 17,098,881 (GRCm39) missense probably benign 0.16
X0028:Prune2 UTSW 19 17,100,249 (GRCm39) missense probably damaging 1.00
X0064:Prune2 UTSW 19 17,099,739 (GRCm39) missense probably damaging 1.00
X0066:Prune2 UTSW 19 17,096,154 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGCGCCCATAGCTTC -3'
(R):5'- CAGGATAGAGTGGAGTTGGCTC -3'

Sequencing Primer
(F):5'- TTCAGAGCAGTCCCAGCC -3'
(R):5'- CCTCATTTGATGGTGAGATTTCCAC -3'
Posted On 2020-06-30