Incidental Mutation 'R8130:Olfr1107'
ID 631947
Institutional Source Beutler Lab
Gene Symbol Olfr1107
Ensembl Gene ENSMUSG00000075163
Gene Name olfactory receptor 1107
Synonyms GA_x6K02T2Q125-48565383-48564445, MOR172-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8130 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87068671-87075817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87071226 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 303 (K303E)
Ref Sequence ENSEMBL: ENSMUSP00000150135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099865] [ENSMUST00000214049]
AlphaFold A2AVB8
Predicted Effect probably benign
Transcript: ENSMUST00000099865
AA Change: K303E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097450
Gene: ENSMUSG00000075163
AA Change: K303E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-53 PFAM
Pfam:7tm_1 41 290 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214049
AA Change: K303E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,009 I130M probably damaging Het
4921539E11Rik T C 4: 103,235,698 D142G probably damaging Het
4931428F04Rik G A 8: 105,285,513 R101W probably benign Het
Abcb10 C T 8: 123,965,018 A403T Het
Arfgef2 T A 2: 166,836,250 S218T possibly damaging Het
Armc8 C T 9: 99,551,547 V40I probably benign Het
C87414 A T 5: 93,636,738 L289Q probably damaging Het
Caps2 A T 10: 112,182,476 D177V probably benign Het
Cdh8 A T 8: 99,031,044 F641I probably damaging Het
Cemip T C 7: 83,947,176 S1127G probably benign Het
Cmtm1 C A 8: 104,309,456 Q180H unknown Het
Col15a1 C T 4: 47,312,196 T1337I probably damaging Het
Col18a1 A T 10: 77,074,450 M555K probably benign Het
Ctrb1 A G 8: 111,689,191 F89L possibly damaging Het
Disp1 T C 1: 183,135,635 T76A probably benign Het
Dpep1 T C 8: 123,200,226 V263A probably damaging Het
Dysf G A 6: 84,137,376 E1216K probably damaging Het
F830016B08Rik A G 18: 60,299,980 Y45C probably benign Het
Fam186a CGG CG 15: 99,944,033 probably null Het
Gcm1 T A 9: 78,064,534 D252E probably benign Het
Gm11559 A G 11: 99,864,590 T22A unknown Het
Gm4847 C T 1: 166,638,348 R224Q probably damaging Het
Gm4869 C T 5: 140,474,961 R461C probably damaging Het
Hypk A G 2: 121,456,378 probably benign Het
I830077J02Rik C T 3: 105,926,917 C64Y possibly damaging Het
Igkv4-86 T C 6: 68,910,666 I30V probably benign Het
Il17ra A G 6: 120,478,455 I342V probably benign Het
Kcnip3 C T 2: 127,510,908 A64T possibly damaging Het
Kdm5d T A Y: 940,658 D1056E possibly damaging Het
Krtap19-2 C T 16: 88,874,015 G81R unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lpin1 A T 12: 16,579,964 I69N Het
Mki67 C T 7: 135,697,564 D1914N probably damaging Het
Mmrn1 A T 6: 60,960,723 Q235L probably damaging Het
Mndal T A 1: 173,871,545 K185* probably null Het
Muc6 T C 7: 141,647,087 T802A probably damaging Het
Necab1 A T 4: 15,005,073 F130L probably damaging Het
Nemf A T 12: 69,356,052 M70K possibly damaging Het
Nploc4 A G 11: 120,389,414 I436T possibly damaging Het
Obscn C A 11: 59,124,613 R1011M probably damaging Het
Olfr1058 T A 2: 86,385,567 M284L probably benign Het
Olfr1294 A T 2: 111,537,480 F270I probably damaging Het
Ormdl1 T A 1: 53,298,980 M1K probably null Het
Psmb3 A G 11: 97,703,897 D38G probably benign Het
Psme4 T A 11: 30,842,026 L1171Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc22a18 G A 7: 143,499,174 V379I probably damaging Het
Speg T A 1: 75,415,596 F1632L probably damaging Het
Taok1 G A 11: 77,579,833 R49C possibly damaging Het
Ttll6 T C 11: 96,156,599 S675P probably benign Het
Usp8 A T 2: 126,717,998 probably benign Het
Vmn2r81 T A 10: 79,274,704 N550K possibly damaging Het
Zfp119a A T 17: 55,865,971 C291S probably damaging Het
Zfp329 C A 7: 12,810,386 G404C probably damaging Het
Zfp934 C A 13: 62,520,171 probably null Het
Other mutations in Olfr1107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Olfr1107 APN 2 87071219 missense probably benign 0.00
IGL01521:Olfr1107 APN 2 87071733 missense probably benign 0.11
IGL03350:Olfr1107 APN 2 87071560 missense probably damaging 1.00
PIT4791001:Olfr1107 UTSW 2 87071702 missense possibly damaging 0.94
R0801:Olfr1107 UTSW 2 87072063 nonsense probably null
R1383:Olfr1107 UTSW 2 87071792 missense probably damaging 1.00
R1577:Olfr1107 UTSW 2 87071397 missense probably benign 0.15
R1762:Olfr1107 UTSW 2 87071921 missense probably damaging 1.00
R2027:Olfr1107 UTSW 2 87071553 missense possibly damaging 0.85
R3850:Olfr1107 UTSW 2 87071966 missense possibly damaging 0.89
R5345:Olfr1107 UTSW 2 87071492 missense possibly damaging 0.61
R5409:Olfr1107 UTSW 2 87071870 missense possibly damaging 0.64
R5451:Olfr1107 UTSW 2 87071997 missense probably damaging 1.00
R5735:Olfr1107 UTSW 2 87071412 missense probably damaging 1.00
R6091:Olfr1107 UTSW 2 87071361 missense probably benign 0.03
R6869:Olfr1107 UTSW 2 87071673 missense probably benign 0.11
R7080:Olfr1107 UTSW 2 87071739 missense probably damaging 1.00
R8147:Olfr1107 UTSW 2 87071673 missense probably benign 0.11
R9087:Olfr1107 UTSW 2 87071955 missense probably damaging 1.00
R9619:Olfr1107 UTSW 2 87071796 missense possibly damaging 0.94
Z1177:Olfr1107 UTSW 2 87071765 missense possibly damaging 0.72
Z1177:Olfr1107 UTSW 2 87072113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGTAGAGCCATGTAAAAGAATCC -3'
(R):5'- TGCTTCACACCTGACAGCTG -3'

Sequencing Primer
(F):5'- GCCATGTAAAAGAATCCATGAGAAC -3'
(R):5'- AGTACTCCATGGAACAGG -3'
Posted On 2020-06-30