Incidental Mutation 'R8130:Usp8'
ID631950
Institutional Source Beutler Lab
Gene Symbol Usp8
Ensembl Gene ENSMUSG00000027363
Gene Nameubiquitin specific peptidase 8
SynonymsUbpy
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8130 (G1)
Quality Score190.009
Status Not validated
Chromosome2
Chromosomal Location126707328-126759297 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 126717998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000110416] [ENSMUST00000136319]
Predicted Effect probably benign
Transcript: ENSMUST00000028841
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110416
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the ubiquitin-specific processing protease family of proteins. The encoded protein is thought to regulate the morphology of the endosome by ubiquitination of proteins on this organelle and is involved in cargo sorting and membrane trafficking at the early endosome stage. This protein is required for the cell to enter the S phase of the cell cycle and also functions as a positive regulator in the Hedgehog signaling pathway in development. Pseudogenes of this gene are present on chromosomes 2 and 6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele appear severely growth retarded and disorganized at E9.5 and die in utero due to ventral-folding defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,009 I130M probably damaging Het
4921539E11Rik T C 4: 103,235,698 D142G probably damaging Het
4931428F04Rik G A 8: 105,285,513 R101W probably benign Het
Abcb10 C T 8: 123,965,018 A403T Het
Arfgef2 T A 2: 166,836,250 S218T possibly damaging Het
Armc8 C T 9: 99,551,547 V40I probably benign Het
C87414 A T 5: 93,636,738 L289Q probably damaging Het
Caps2 A T 10: 112,182,476 D177V probably benign Het
Cdh8 A T 8: 99,031,044 F641I probably damaging Het
Cemip T C 7: 83,947,176 S1127G probably benign Het
Cmtm1 C A 8: 104,309,456 Q180H unknown Het
Col15a1 C T 4: 47,312,196 T1337I probably damaging Het
Col18a1 A T 10: 77,074,450 M555K probably benign Het
Ctrb1 A G 8: 111,689,191 F89L possibly damaging Het
Disp1 T C 1: 183,135,635 T76A probably benign Het
Dpep1 T C 8: 123,200,226 V263A probably damaging Het
Dysf G A 6: 84,137,376 E1216K probably damaging Het
F830016B08Rik A G 18: 60,299,980 Y45C probably benign Het
Fam186a CGG CG 15: 99,944,033 probably null Het
Gcm1 T A 9: 78,064,534 D252E probably benign Het
Gm11559 A G 11: 99,864,590 T22A unknown Het
Gm4847 C T 1: 166,638,348 R224Q probably damaging Het
Gm4869 C T 5: 140,474,961 R461C probably damaging Het
Hypk A G 2: 121,456,378 probably benign Het
I830077J02Rik C T 3: 105,926,917 C64Y possibly damaging Het
Igkv4-86 T C 6: 68,910,666 I30V probably benign Het
Il17ra A G 6: 120,478,455 I342V probably benign Het
Kcnip3 C T 2: 127,510,908 A64T possibly damaging Het
Kdm5d T A Y: 940,658 D1056E possibly damaging Het
Krtap19-2 C T 16: 88,874,015 G81R unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lpin1 A T 12: 16,579,964 I69N Het
Mki67 C T 7: 135,697,564 D1914N probably damaging Het
Mmrn1 A T 6: 60,960,723 Q235L probably damaging Het
Mndal T A 1: 173,871,545 K185* probably null Het
Muc6 T C 7: 141,647,087 T802A probably damaging Het
Necab1 A T 4: 15,005,073 F130L probably damaging Het
Nemf A T 12: 69,356,052 M70K possibly damaging Het
Nploc4 A G 11: 120,389,414 I436T possibly damaging Het
Obscn C A 11: 59,124,613 R1011M probably damaging Het
Olfr1058 T A 2: 86,385,567 M284L probably benign Het
Olfr1107 T C 2: 87,071,226 K303E probably benign Het
Olfr1294 A T 2: 111,537,480 F270I probably damaging Het
Ormdl1 T A 1: 53,298,980 M1K probably null Het
Psmb3 A G 11: 97,703,897 D38G probably benign Het
Psme4 T A 11: 30,842,026 L1171Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc22a18 G A 7: 143,499,174 V379I probably damaging Het
Speg T A 1: 75,415,596 F1632L probably damaging Het
Taok1 G A 11: 77,579,833 R49C possibly damaging Het
Ttll6 T C 11: 96,156,599 S675P probably benign Het
Vmn2r81 T A 10: 79,274,704 N550K possibly damaging Het
Zfp119a A T 17: 55,865,971 C291S probably damaging Het
Zfp329 C A 7: 12,810,386 G404C probably damaging Het
Zfp934 C A 13: 62,520,171 probably null Het
Other mutations in Usp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Usp8 APN 2 126758560 missense probably damaging 1.00
IGL00771:Usp8 APN 2 126725433 splice site probably null
IGL01073:Usp8 APN 2 126718114 missense probably damaging 0.96
IGL01722:Usp8 APN 2 126758152 missense probably damaging 1.00
IGL02100:Usp8 APN 2 126737854 intron probably benign
IGL02210:Usp8 APN 2 126718056 intron probably benign
IGL02516:Usp8 APN 2 126742174 missense probably benign 0.00
IGL02743:Usp8 APN 2 126734023 missense probably damaging 1.00
IGL02953:Usp8 APN 2 126737937 missense probably benign
satsuke UTSW 2 126751111 missense probably damaging 1.00
R0045:Usp8 UTSW 2 126742223 missense probably benign 0.03
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0048:Usp8 UTSW 2 126737889 missense probably damaging 0.96
R0143:Usp8 UTSW 2 126755089 intron probably benign
R0427:Usp8 UTSW 2 126718032 intron probably benign
R0440:Usp8 UTSW 2 126725390 missense probably benign 0.00
R0636:Usp8 UTSW 2 126720110 missense possibly damaging 0.87
R0828:Usp8 UTSW 2 126742114 intron probably benign
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1468:Usp8 UTSW 2 126754927 missense probably damaging 1.00
R1782:Usp8 UTSW 2 126720051 missense probably damaging 1.00
R1860:Usp8 UTSW 2 126756040 missense probably damaging 1.00
R2127:Usp8 UTSW 2 126737575 intron probably null
R2259:Usp8 UTSW 2 126758568 missense probably benign 0.32
R2892:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R2893:Usp8 UTSW 2 126758155 missense probably damaging 1.00
R3104:Usp8 UTSW 2 126758512 missense probably damaging 1.00
R4074:Usp8 UTSW 2 126752370 missense probably damaging 1.00
R4678:Usp8 UTSW 2 126725429 missense probably null 1.00
R4715:Usp8 UTSW 2 126729222 missense possibly damaging 0.80
R4832:Usp8 UTSW 2 126755038 missense probably damaging 1.00
R4914:Usp8 UTSW 2 126720140 nonsense probably null
R4915:Usp8 UTSW 2 126720140 nonsense probably null
R4918:Usp8 UTSW 2 126720140 nonsense probably null
R5262:Usp8 UTSW 2 126751111 missense probably damaging 1.00
R5625:Usp8 UTSW 2 126742277 missense probably damaging 1.00
R5667:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5671:Usp8 UTSW 2 126742425 missense probably benign 0.00
R5984:Usp8 UTSW 2 126742481 missense probably benign 0.10
R6529:Usp8 UTSW 2 126725378 missense probably benign 0.01
R6551:Usp8 UTSW 2 126733182 intron probably benign
R6885:Usp8 UTSW 2 126752310 missense probably damaging 1.00
R7768:Usp8 UTSW 2 126751123 missense probably damaging 1.00
R8097:Usp8 UTSW 2 126754880 missense probably benign 0.44
Z1177:Usp8 UTSW 2 126758431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTACATTCTGAAGCACCCC -3'
(R):5'- CTAGCACACACTTCTTGGTGC -3'

Sequencing Primer
(F):5'- ATTCATTCTGCTGGTCATCAGAG -3'
(R):5'- GCTGGTTTTCTCAGGTTTAACTTC -3'
Posted On2020-06-30