Incidental Mutation 'R8130:Mmrn1'
ID 631962
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms 4921530G03Rik, Emilin4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8130 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 60924976-60989378 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60960723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 235 (Q235L)
Ref Sequence ENSEMBL: ENSMUSP00000119609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000129603
AA Change: Q235L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: Q235L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204333
AA Change: Q235L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: Q235L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,009 I130M probably damaging Het
4921539E11Rik T C 4: 103,235,698 D142G probably damaging Het
4931428F04Rik G A 8: 105,285,513 R101W probably benign Het
Abcb10 C T 8: 123,965,018 A403T Het
Arfgef2 T A 2: 166,836,250 S218T possibly damaging Het
Armc8 C T 9: 99,551,547 V40I probably benign Het
C87414 A T 5: 93,636,738 L289Q probably damaging Het
Caps2 A T 10: 112,182,476 D177V probably benign Het
Cdh8 A T 8: 99,031,044 F641I probably damaging Het
Cemip T C 7: 83,947,176 S1127G probably benign Het
Cmtm1 C A 8: 104,309,456 Q180H unknown Het
Col15a1 C T 4: 47,312,196 T1337I probably damaging Het
Col18a1 A T 10: 77,074,450 M555K probably benign Het
Ctrb1 A G 8: 111,689,191 F89L possibly damaging Het
Disp1 T C 1: 183,135,635 T76A probably benign Het
Dpep1 T C 8: 123,200,226 V263A probably damaging Het
Dysf G A 6: 84,137,376 E1216K probably damaging Het
F830016B08Rik A G 18: 60,299,980 Y45C probably benign Het
Fam186a CGG CG 15: 99,944,033 probably null Het
Gcm1 T A 9: 78,064,534 D252E probably benign Het
Gm11559 A G 11: 99,864,590 T22A unknown Het
Gm4847 C T 1: 166,638,348 R224Q probably damaging Het
Gm4869 C T 5: 140,474,961 R461C probably damaging Het
Hypk A G 2: 121,456,378 probably benign Het
I830077J02Rik C T 3: 105,926,917 C64Y possibly damaging Het
Igkv4-86 T C 6: 68,910,666 I30V probably benign Het
Il17ra A G 6: 120,478,455 I342V probably benign Het
Kcnip3 C T 2: 127,510,908 A64T possibly damaging Het
Kdm5d T A Y: 940,658 D1056E possibly damaging Het
Krtap19-2 C T 16: 88,874,015 G81R unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lpin1 A T 12: 16,579,964 I69N Het
Mki67 C T 7: 135,697,564 D1914N probably damaging Het
Mndal T A 1: 173,871,545 K185* probably null Het
Muc6 T C 7: 141,647,087 T802A probably damaging Het
Necab1 A T 4: 15,005,073 F130L probably damaging Het
Nemf A T 12: 69,356,052 M70K possibly damaging Het
Nploc4 A G 11: 120,389,414 I436T possibly damaging Het
Obscn C A 11: 59,124,613 R1011M probably damaging Het
Olfr1058 T A 2: 86,385,567 M284L probably benign Het
Olfr1107 T C 2: 87,071,226 K303E probably benign Het
Olfr1294 A T 2: 111,537,480 F270I probably damaging Het
Ormdl1 T A 1: 53,298,980 M1K probably null Het
Psmb3 A G 11: 97,703,897 D38G probably benign Het
Psme4 T A 11: 30,842,026 L1171Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc22a18 G A 7: 143,499,174 V379I probably damaging Het
Speg T A 1: 75,415,596 F1632L probably damaging Het
Taok1 G A 11: 77,579,833 R49C possibly damaging Het
Ttll6 T C 11: 96,156,599 S675P probably benign Het
Usp8 A T 2: 126,717,998 probably benign Het
Vmn2r81 T A 10: 79,274,704 N550K possibly damaging Het
Zfp119a A T 17: 55,865,971 C291S probably damaging Het
Zfp329 C A 7: 12,810,386 G404C probably damaging Het
Zfp934 C A 13: 62,520,171 probably null Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8472:Mmrn1 UTSW 6 60988396 missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60987209 missense possibly damaging 0.54
R8803:Mmrn1 UTSW 6 60988287 missense probably damaging 1.00
R8879:Mmrn1 UTSW 6 60976529 missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60976093 missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60976058 missense probably benign 0.04
R9200:Mmrn1 UTSW 6 60976876 missense probably damaging 1.00
R9287:Mmrn1 UTSW 6 60975955 missense probably damaging 1.00
R9387:Mmrn1 UTSW 6 60958192 nonsense probably null
R9612:Mmrn1 UTSW 6 60976424 missense probably damaging 0.96
R9674:Mmrn1 UTSW 6 60971088 nonsense probably null
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCAATAGTGAAACCACTCATGTTTC -3'
(R):5'- TCTAAAAGAGCAATAGGCCTAAAGC -3'

Sequencing Primer
(F):5'- GTGAAACCACTCATGTTTCAATTGC -3'
(R):5'- TAAAGCCTGGCTGCTCAC -3'
Posted On 2020-06-30