Incidental Mutation 'R8130:Igkv4-86'
ID631963
Institutional Source Beutler Lab
Gene Symbol Igkv4-86
Ensembl Gene ENSMUSG00000076536
Gene Nameimmunoglobulin kappa variable 4-86
SynonymsLOC243451
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8130 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location68910411-68910938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68910666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 30 (I30V)
Ref Sequence ENSEMBL: ENSMUSP00000143537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103337] [ENSMUST00000200454]
Predicted Effect probably benign
Transcript: ENSMUST00000103337
AA Change: I29V

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100138
Gene: ENSMUSG00000076536
AA Change: I29V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 37 108 2.16e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200454
AA Change: I30V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143537
Gene: ENSMUSG00000076536
AA Change: I30V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGv 38 109 9.3e-20 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,009 I130M probably damaging Het
4921539E11Rik T C 4: 103,235,698 D142G probably damaging Het
4931428F04Rik G A 8: 105,285,513 R101W probably benign Het
Abcb10 C T 8: 123,965,018 A403T Het
Arfgef2 T A 2: 166,836,250 S218T possibly damaging Het
Armc8 C T 9: 99,551,547 V40I probably benign Het
C87414 A T 5: 93,636,738 L289Q probably damaging Het
Caps2 A T 10: 112,182,476 D177V probably benign Het
Cdh8 A T 8: 99,031,044 F641I probably damaging Het
Cemip T C 7: 83,947,176 S1127G probably benign Het
Cmtm1 C A 8: 104,309,456 Q180H unknown Het
Col15a1 C T 4: 47,312,196 T1337I probably damaging Het
Col18a1 A T 10: 77,074,450 M555K probably benign Het
Ctrb1 A G 8: 111,689,191 F89L possibly damaging Het
Disp1 T C 1: 183,135,635 T76A probably benign Het
Dpep1 T C 8: 123,200,226 V263A probably damaging Het
Dysf G A 6: 84,137,376 E1216K probably damaging Het
F830016B08Rik A G 18: 60,299,980 Y45C probably benign Het
Fam186a CGG CG 15: 99,944,033 probably null Het
Gcm1 T A 9: 78,064,534 D252E probably benign Het
Gm11559 A G 11: 99,864,590 T22A unknown Het
Gm4847 C T 1: 166,638,348 R224Q probably damaging Het
Gm4869 C T 5: 140,474,961 R461C probably damaging Het
Hypk A G 2: 121,456,378 probably benign Het
I830077J02Rik C T 3: 105,926,917 C64Y possibly damaging Het
Il17ra A G 6: 120,478,455 I342V probably benign Het
Kcnip3 C T 2: 127,510,908 A64T possibly damaging Het
Kdm5d T A Y: 940,658 D1056E possibly damaging Het
Krtap19-2 C T 16: 88,874,015 G81R unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lpin1 A T 12: 16,579,964 I69N Het
Mki67 C T 7: 135,697,564 D1914N probably damaging Het
Mmrn1 A T 6: 60,960,723 Q235L probably damaging Het
Mndal T A 1: 173,871,545 K185* probably null Het
Muc6 T C 7: 141,647,087 T802A probably damaging Het
Necab1 A T 4: 15,005,073 F130L probably damaging Het
Nemf A T 12: 69,356,052 M70K possibly damaging Het
Nploc4 A G 11: 120,389,414 I436T possibly damaging Het
Obscn C A 11: 59,124,613 R1011M probably damaging Het
Olfr1058 T A 2: 86,385,567 M284L probably benign Het
Olfr1107 T C 2: 87,071,226 K303E probably benign Het
Olfr1294 A T 2: 111,537,480 F270I probably damaging Het
Ormdl1 T A 1: 53,298,980 M1K probably null Het
Psmb3 A G 11: 97,703,897 D38G probably benign Het
Psme4 T A 11: 30,842,026 L1171Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc22a18 G A 7: 143,499,174 V379I probably damaging Het
Speg T A 1: 75,415,596 F1632L probably damaging Het
Taok1 G A 11: 77,579,833 R49C possibly damaging Het
Ttll6 T C 11: 96,156,599 S675P probably benign Het
Usp8 A T 2: 126,717,998 probably benign Het
Vmn2r81 T A 10: 79,274,704 N550K possibly damaging Het
Zfp119a A T 17: 55,865,971 C291S probably damaging Het
Zfp329 C A 7: 12,810,386 G404C probably damaging Het
Zfp934 C A 13: 62,520,171 probably null Het
Other mutations in Igkv4-86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02650:Igkv4-86 APN 6 68910633 missense probably benign 0.01
R5580:Igkv4-86 UTSW 6 68911006 unclassified probably benign
R5611:Igkv4-86 UTSW 6 68910675 missense probably damaging 1.00
R7763:Igkv4-86 UTSW 6 68910579 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATCTTCAGCCTCCATGC -3'
(R):5'- GCAACCAAAATTATTTTCCCTGGG -3'

Sequencing Primer
(F):5'- CCTCCATGCTGCTGATTGTGAG -3'
(R):5'- CCCTGGGAAATTTGAGTCTAAAATAC -3'
Posted On2020-06-30