Mutagenetix > Incidental Mutation

Incidental Mutation 'R0707:Kalrn'

63197

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

038890-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R0707 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 34010581 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 723 (N723H)

Ref Sequence

ENSEMBL: ENSMUSP00000110624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114963] [ENSMUST00000114964] [ENSMUST00000114966] [ENSMUST00000114973] [ENSMUST00000232157]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076810
AA Change: N2392H

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: N2392H

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114963

SMART Domains

Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SH3	22	83	1.23e-7	SMART
RhoGEF	273	443	1.47e-52	SMART
PH	463	568	9.87e-4	SMART
SH3	664	725	2.78e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114964

SMART Domains

Protein: ENSMUSP00000110615
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
RhoGEF	204	374	1.47e-52	SMART
PH	394	499	9.87e-4	SMART
SH3	595	656	2.78e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114966

SMART Domains

Protein: ENSMUSP00000110617
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
RhoGEF	235	405	1.47e-52	SMART
PH	425	530	9.87e-4	SMART
SH3	626	687	2.78e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114973
AA Change: N723H

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: N723H

Domain	Start	End	E-Value	Type
RhoGEF	235	405	1.47e-52	SMART
PH	425	530	9.87e-4	SMART
SH3	626	687	2.78e-2	SMART
IGc2	786	858	4.28e-12	SMART
FN3	872	954	3.07e-11	SMART
S_TKc	987	1241	1.28e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142817

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231657

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231993

Predicted Effect

probably benign
Transcript: ENSMUST00000232157

Meta Mutation Damage Score

0.0666

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,258,321 (GRCm38)	N2881K	unknown	Het
Acot11	A	G	4: 106,760,132 (GRCm38)	F259S	probably damaging	Het
Aldh16a1	T	A	7: 45,144,507 (GRCm38)		probably benign	Het
Ankrd24	A	T	10: 81,642,713 (GRCm38)		probably benign	Het
Arhgap5	T	C	12: 52,518,168 (GRCm38)	S641P	probably damaging	Het
Arpp21	A	C	9: 112,157,756 (GRCm38)	S242R	probably benign	Het
Bpifb5	A	G	2: 154,228,900 (GRCm38)	T204A	probably benign	Het
Bud31	A	G	5: 145,146,455 (GRCm38)	Y77C	probably damaging	Het
Ccdc65	G	A	15: 98,709,214 (GRCm38)	V101I	possibly damaging	Het
Ccr7	T	A	11: 99,145,983 (GRCm38)	T38S	probably damaging	Het
Cdc14a	T	C	3: 116,293,713 (GRCm38)		probably benign	Het
Ces2f	C	T	8: 104,950,986 (GRCm38)	H208Y	possibly damaging	Het
Chst1	C	A	2: 92,613,619 (GRCm38)	N145K	possibly damaging	Het
Clock	A	G	5: 76,227,129 (GRCm38)	V731A	possibly damaging	Het
Cog6	C	T	3: 53,013,862 (GRCm38)	V108I	possibly damaging	Het
Crtc2	T	A	3: 90,263,497 (GRCm38)	F626I	probably damaging	Het
Dicer1	A	T	12: 104,706,885 (GRCm38)	F792I	probably damaging	Het
Dnajc13	T	C	9: 104,172,582 (GRCm38)	K1780R	probably benign	Het
Dph5	A	C	3: 115,915,133 (GRCm38)	N155H	probably benign	Het
Dscam	T	C	16: 96,825,782 (GRCm38)		probably null	Het
Etl4	C	A	2: 20,805,571 (GRCm38)		probably benign	Het
Flt3l	T	C	7: 45,136,026 (GRCm38)	S9G	probably benign	Het
Fmnl2	A	G	2: 53,054,486 (GRCm38)	E159G	possibly damaging	Het
Fryl	A	G	5: 73,083,372 (GRCm38)	I1295T	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224 (GRCm38)		probably null	Het
Gatad2b	T	A	3: 90,356,182 (GRCm38)	S529T	probably benign	Het
Herc6	G	A	6: 57,662,362 (GRCm38)	G905E	possibly damaging	Het
Hhip	T	A	8: 79,998,255 (GRCm38)	N296I	probably damaging	Het
Hmgcr	A	T	13: 96,650,643 (GRCm38)		probably benign	Het
Mroh5	T	A	15: 73,790,739 (GRCm38)	Y242F	possibly damaging	Het
Msh3	T	A	13: 92,347,340 (GRCm38)	K258*	probably null	Het
Myo1a	T	C	10: 127,719,863 (GRCm38)		probably benign	Het
Nlrp4f	C	T	13: 65,194,503 (GRCm38)	E443K	probably benign	Het
Nupr1l	A	G	5: 129,908,692 (GRCm38)	Y34C	probably damaging	Het
Ociad1	T	C	5: 73,294,912 (GRCm38)		probably benign	Het
Olfr1469	A	T	19: 13,411,420 (GRCm38)	M284L	probably benign	Het
Olfr313	T	A	11: 58,817,751 (GRCm38)	L248M	probably damaging	Het
Olfr366	A	T	2: 37,220,196 (GRCm38)	K236*	probably null	Het
Olfr467	A	G	7: 107,815,124 (GRCm38)	D182G	probably damaging	Het
Olfr522	T	C	7: 140,162,089 (GRCm38)	N287S	probably damaging	Het
P2ry12	C	A	3: 59,217,487 (GRCm38)	V256F	probably damaging	Het
Pcdhb22	T	A	18: 37,518,851 (GRCm38)	I124N	probably damaging	Het
Pcnt	A	G	10: 76,420,541 (GRCm38)	F622L	probably damaging	Het
Pfas	A	T	11: 68,998,037 (GRCm38)	N361K	probably benign	Het
Plod2	T	G	9: 92,605,427 (GRCm38)	L600V	possibly damaging	Het
Pole	T	C	5: 110,298,988 (GRCm38)	Y631H	probably damaging	Het
Proser1	T	C	3: 53,478,776 (GRCm38)	L693P	probably damaging	Het
Ptprd	A	G	4: 75,957,239 (GRCm38)	Y1195H	probably damaging	Het
Rbm27	T	A	18: 42,326,026 (GRCm38)		probably null	Het
Ric8a	A	G	7: 140,857,973 (GRCm38)		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324 (GRCm38)		probably benign	Het
Rimkla	C	T	4: 119,477,980 (GRCm38)	V69M	probably damaging	Het
Scfd1	A	T	12: 51,412,577 (GRCm38)	K307M	probably damaging	Het
Sh2b2	A	G	5: 136,232,263 (GRCm38)	F33S	probably damaging	Het
Smg7	T	G	1: 152,870,757 (GRCm38)		probably null	Het
Srebf1	T	C	11: 60,204,116 (GRCm38)	T486A	probably benign	Het
Strn3	G	A	12: 51,610,404 (GRCm38)	T642I	probably damaging	Het
Syne2	T	C	12: 75,982,063 (GRCm38)		probably null	Het
Syne3	A	G	12: 104,969,360 (GRCm38)	L53P	probably damaging	Het
Tcea1	T	A	1: 4,880,346 (GRCm38)		probably benign	Het
Tmem30b	T	C	12: 73,546,168 (GRCm38)	N58D	probably benign	Het
Tnpo1	A	G	13: 98,855,446 (GRCm38)	Y641H	probably damaging	Het
Trim25	A	T	11: 88,999,738 (GRCm38)	T84S	probably benign	Het
Trip4	A	T	9: 65,839,004 (GRCm38)	F537I	possibly damaging	Het
Uaca	G	A	9: 60,848,618 (GRCm38)		probably benign	Het
Ugt2b34	T	A	5: 86,892,899 (GRCm38)	Y388F	possibly damaging	Het
Vmn2r71	T	C	7: 85,619,432 (GRCm38)	V281A	probably benign	Het
Vps13d	A	T	4: 145,155,932 (GRCm38)	D1030E	probably damaging	Het
Vps8	C	A	16: 21,442,357 (GRCm38)	F82L	probably damaging	Het
Zfp296	A	G	7: 19,579,736 (GRCm38)	D172G	probably benign	Het
Zfp977	C	A	7: 42,580,534 (GRCm38)	C189F	probably damaging	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34,175,722 (GRCm38)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,262,629 (GRCm38)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,235,330 (GRCm38)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,294,161 (GRCm38)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,198,512 (GRCm38)	splice site	probably null
IGL02059:Kalrn	APN	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,220,222 (GRCm38)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,310,527 (GRCm38)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,332,224 (GRCm38)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,360,846 (GRCm38)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,513,959 (GRCm38)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,220,114 (GRCm38)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,392,050 (GRCm38)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,220,130 (GRCm38)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,314,192 (GRCm38)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,385,297 (GRCm38)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,314,176 (GRCm38)	missense	probably damaging	0.99
breeze	UTSW	16	34,013,675 (GRCm38)	missense
ethereal	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
Feather	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
Hidden	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
Soulful	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,198,514 (GRCm38)	splice site	probably benign
R0043:Kalrn	UTSW	16	34,054,906 (GRCm38)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,357,171 (GRCm38)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34,031,590 (GRCm38)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34,049,936 (GRCm38)	intron	probably benign
R0183:Kalrn	UTSW	16	34,171,379 (GRCm38)	splice site	probably null
R0422:Kalrn	UTSW	16	34,314,273 (GRCm38)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34,054,891 (GRCm38)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,993,670 (GRCm38)	splice site	probably benign
R0656:Kalrn	UTSW	16	34,032,467 (GRCm38)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34,116,408 (GRCm38)	missense	probably benign	0.04
R0709:Kalrn	UTSW	16	34,035,554 (GRCm38)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34,049,919 (GRCm38)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,385,390 (GRCm38)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34,016,498 (GRCm38)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,988,803 (GRCm38)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,212,820 (GRCm38)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,975,754 (GRCm38)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34,174,487 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,314,278 (GRCm38)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34,010,548 (GRCm38)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,360,950 (GRCm38)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,212,873 (GRCm38)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,294,215 (GRCm38)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,356,961 (GRCm38)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,975,923 (GRCm38)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,977,524 (GRCm38)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34,028,045 (GRCm38)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,189,736 (GRCm38)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,252,310 (GRCm38)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,332,143 (GRCm38)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,332,230 (GRCm38)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,307,724 (GRCm38)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34,009,262 (GRCm38)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34,176,262 (GRCm38)	splice site	probably null
R2404:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,310,495 (GRCm38)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,212,272 (GRCm38)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,357,315 (GRCm38)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,392,030 (GRCm38)	splice site	probably null
R3788:Kalrn	UTSW	16	34,220,240 (GRCm38)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34,039,889 (GRCm38)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,203,856 (GRCm38)	splice site	probably null
R3934:Kalrn	UTSW	16	34,310,531 (GRCm38)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,235,391 (GRCm38)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,987,208 (GRCm38)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,392,042 (GRCm38)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,235,267 (GRCm38)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,513,926 (GRCm38)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34,028,705 (GRCm38)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34,176,391 (GRCm38)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,198,487 (GRCm38)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,356,969 (GRCm38)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,514,019 (GRCm38)	unclassified	probably benign
R4888:Kalrn	UTSW	16	34,171,330 (GRCm38)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,357,415 (GRCm38)	splice site	probably null
R5030:Kalrn	UTSW	16	33,975,742 (GRCm38)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,314,352 (GRCm38)	nonsense	probably null
R5117:Kalrn	UTSW	16	34,033,601 (GRCm38)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,262,653 (GRCm38)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34,053,622 (GRCm38)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34,175,780 (GRCm38)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34,039,934 (GRCm38)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34,014,084 (GRCm38)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34,016,579 (GRCm38)	missense	probably benign
R5716:Kalrn	UTSW	16	33,987,176 (GRCm38)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,975,820 (GRCm38)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,212,249 (GRCm38)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,987,091 (GRCm38)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,243,833 (GRCm38)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,357,343 (GRCm38)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34,010,580 (GRCm38)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,360,885 (GRCm38)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,985,191 (GRCm38)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,212,885 (GRCm38)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,357,111 (GRCm38)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34,053,639 (GRCm38)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34,055,071 (GRCm38)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,975,991 (GRCm38)	missense	probably benign
R6397:Kalrn	UTSW	16	33,992,985 (GRCm38)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,332,164 (GRCm38)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,205,302 (GRCm38)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,360,984 (GRCm38)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,182,747 (GRCm38)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,217,923 (GRCm38)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,975,703 (GRCm38)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,220,136 (GRCm38)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,357,048 (GRCm38)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,217,891 (GRCm38)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,256,227 (GRCm38)	missense	unknown
R7154:Kalrn	UTSW	16	34,212,157 (GRCm38)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34,163,077 (GRCm38)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34,176,422 (GRCm38)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34,175,761 (GRCm38)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,256,233 (GRCm38)	missense	unknown
R7563:Kalrn	UTSW	16	34,392,094 (GRCm38)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,314,212 (GRCm38)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,989,791 (GRCm38)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,988,847 (GRCm38)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34,028,752 (GRCm38)	missense	probably benign
R8080:Kalrn	UTSW	16	33,975,668 (GRCm38)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34,055,044 (GRCm38)	missense	probably benign
R8239:Kalrn	UTSW	16	34,049,783 (GRCm38)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34,035,061 (GRCm38)	nonsense	probably null
R8294:Kalrn	UTSW	16	34,033,584 (GRCm38)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,360,935 (GRCm38)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34,034,514 (GRCm38)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,982,855 (GRCm38)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,198,460 (GRCm38)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,217,935 (GRCm38)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,993,655 (GRCm38)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,227,126 (GRCm38)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34,034,484 (GRCm38)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,361,001 (GRCm38)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34,013,675 (GRCm38)	missense
R9424:Kalrn	UTSW	16	33,988,818 (GRCm38)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34,095,879 (GRCm38)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,985,230 (GRCm38)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34,028,827 (GRCm38)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,212,213 (GRCm38)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34,039,933 (GRCm38)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34,035,506 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGCAGTGGTCAAATAGCCAATC -3'
(R):5'- GGTCAAAGTTCATCCTCACTCCCAG -3'

Sequencing Primer
(F):5'- TGGTCAAATAGCCAATCCCCAC -3'
(R):5'- TCACTCCCAGTTAGAGGTGAG -3'

Posted On

2013-07-30