Mutagenetix > Incidental Mutation

Incidental Mutation 'R8130:Psme4'

631982

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8130 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30842026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1171 (L1171Q)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: L1171Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: L1171Q

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.1%
20x: 97.3%

Validation Efficiency

96% (52/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	T	C	5: 138,563,009	I130M	probably damaging	Het
4921539E11Rik	T	C	4: 103,235,698	D142G	probably damaging	Het
4931428F04Rik	G	A	8: 105,285,513	R101W	probably benign	Het
Abcb10	C	T	8: 123,965,018	A403T		Het
Arfgef2	T	A	2: 166,836,250	S218T	possibly damaging	Het
Armc8	C	T	9: 99,551,547	V40I	probably benign	Het
C87414	A	T	5: 93,636,738	L289Q	probably damaging	Het
Caps2	A	T	10: 112,182,476	D177V	probably benign	Het
Cdh8	A	T	8: 99,031,044	F641I	probably damaging	Het
Cemip	T	C	7: 83,947,176	S1127G	probably benign	Het
Cmtm1	C	A	8: 104,309,456	Q180H	unknown	Het
Col15a1	C	T	4: 47,312,196	T1337I	probably damaging	Het
Col18a1	A	T	10: 77,074,450	M555K	probably benign	Het
Ctrb1	A	G	8: 111,689,191	F89L	possibly damaging	Het
Disp1	T	C	1: 183,135,635	T76A	probably benign	Het
Dpep1	T	C	8: 123,200,226	V263A	probably damaging	Het
Dysf	G	A	6: 84,137,376	E1216K	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,980	Y45C	probably benign	Het
Fam186a	CGG	CG	15: 99,944,033		probably null	Het
Gcm1	T	A	9: 78,064,534	D252E	probably benign	Het
Gm11559	A	G	11: 99,864,590	T22A	unknown	Het
Gm4847	C	T	1: 166,638,348	R224Q	probably damaging	Het
Gm4869	C	T	5: 140,474,961	R461C	probably damaging	Het
Hypk	A	G	2: 121,456,378		probably benign	Het
I830077J02Rik	C	T	3: 105,926,917	C64Y	possibly damaging	Het
Igkv4-86	T	C	6: 68,910,666	I30V	probably benign	Het
Il17ra	A	G	6: 120,478,455	I342V	probably benign	Het
Kcnip3	C	T	2: 127,510,908	A64T	possibly damaging	Het
Kdm5d	T	A	Y: 940,658	D1056E	possibly damaging	Het
Krtap19-2	C	T	16: 88,874,015	G81R	unknown	Het
Ldlrad1	G	A	4: 107,209,491	A8T	probably benign	Het
Lpin1	A	T	12: 16,579,964	I69N		Het
Mki67	C	T	7: 135,697,564	D1914N	probably damaging	Het
Mmrn1	A	T	6: 60,960,723	Q235L	probably damaging	Het
Mndal	T	A	1: 173,871,545	K185*	probably null	Het
Muc6	T	C	7: 141,647,087	T802A	probably damaging	Het
Necab1	A	T	4: 15,005,073	F130L	probably damaging	Het
Nemf	A	T	12: 69,356,052	M70K	possibly damaging	Het
Nploc4	A	G	11: 120,389,414	I436T	possibly damaging	Het
Obscn	C	A	11: 59,124,613	R1011M	probably damaging	Het
Olfr1058	T	A	2: 86,385,567	M284L	probably benign	Het
Olfr1107	T	C	2: 87,071,226	K303E	probably benign	Het
Olfr1294	A	T	2: 111,537,480	F270I	probably damaging	Het
Ormdl1	T	A	1: 53,298,980	M1K	probably null	Het
Psmb3	A	G	11: 97,703,897	D38G	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Slc22a18	G	A	7: 143,499,174	V379I	probably damaging	Het
Speg	T	A	1: 75,415,596	F1632L	probably damaging	Het
Taok1	G	A	11: 77,579,833	R49C	possibly damaging	Het
Ttll6	T	C	11: 96,156,599	S675P	probably benign	Het
Usp8	A	T	2: 126,717,998		probably benign	Het
Vmn2r81	T	A	10: 79,274,704	N550K	possibly damaging	Het
Zfp119a	A	T	17: 55,865,971	C291S	probably damaging	Het
Zfp329	C	A	7: 12,810,386	G404C	probably damaging	Het
Zfp934	C	A	13: 62,520,171		probably null	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTTGTGCAGGGTTTCACAC -3'
(R):5'- ATGCCCAATCATTCCTTTCAAG -3'

Sequencing Primer
(F):5'- ACACCTGTGATTCCAGTTCTCAGAAG -3'
(R):5'- GCCCAATCATTCCTTTCAAGATATTG -3'

Posted On

2020-06-30