Incidental Mutation 'R8130:Psme4'
ID 631982
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 067559-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8130 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30792026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1171 (L1171Q)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: L1171Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: L1171Q

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,561,271 (GRCm39) I130M probably damaging Het
4921539E11Rik T C 4: 103,092,895 (GRCm39) D142G probably damaging Het
Abcb10 C T 8: 124,691,757 (GRCm39) A403T Het
Arfgef2 T A 2: 166,678,170 (GRCm39) S218T possibly damaging Het
Armc8 C T 9: 99,433,600 (GRCm39) V40I probably benign Het
Caps2 A T 10: 112,018,381 (GRCm39) D177V probably benign Het
Cdh8 A T 8: 99,757,676 (GRCm39) F641I probably damaging Het
Cemip T C 7: 83,596,384 (GRCm39) S1127G probably benign Het
Cmtm1 C A 8: 105,036,088 (GRCm39) Q180H unknown Het
Col15a1 C T 4: 47,312,196 (GRCm39) T1337I probably damaging Het
Col18a1 A T 10: 76,910,284 (GRCm39) M555K probably benign Het
Ctrb1 A G 8: 112,415,823 (GRCm39) F89L possibly damaging Het
Disp1 T C 1: 182,917,199 (GRCm39) T76A probably benign Het
Dpep1 T C 8: 123,926,965 (GRCm39) V263A probably damaging Het
Dysf G A 6: 84,114,358 (GRCm39) E1216K probably damaging Het
F830016B08Rik A G 18: 60,433,052 (GRCm39) Y45C probably benign Het
Fam186a CGG CG 15: 99,841,914 (GRCm39) probably null Het
Gcm1 T A 9: 77,971,816 (GRCm39) D252E probably benign Het
Gm11559 A G 11: 99,755,416 (GRCm39) T22A unknown Het
Gm4847 C T 1: 166,465,917 (GRCm39) R224Q probably damaging Het
Hypk A G 2: 121,286,859 (GRCm39) probably benign Het
I830077J02Rik C T 3: 105,834,233 (GRCm39) C64Y possibly damaging Het
Igkv4-86 T C 6: 68,887,650 (GRCm39) I30V probably benign Het
Il17ra A G 6: 120,455,416 (GRCm39) I342V probably benign Het
Kcnip3 C T 2: 127,352,828 (GRCm39) A64T possibly damaging Het
Kdm5d T A Y: 940,658 (GRCm39) D1056E possibly damaging Het
Kif19b C T 5: 140,460,716 (GRCm39) R461C probably damaging Het
Krtap19-2 C T 16: 88,670,903 (GRCm39) G81R unknown Het
Ldlrad1 G A 4: 107,066,688 (GRCm39) A8T probably benign Het
Lpin1 A T 12: 16,629,965 (GRCm39) I69N Het
Matcap1 G A 8: 106,012,145 (GRCm39) R101W probably benign Het
Mki67 C T 7: 135,299,293 (GRCm39) D1914N probably damaging Het
Mmrn1 A T 6: 60,937,707 (GRCm39) Q235L probably damaging Het
Mndal T A 1: 173,699,111 (GRCm39) K185* probably null Het
Muc6 T C 7: 141,233,354 (GRCm39) T802A probably damaging Het
Necab1 A T 4: 15,005,073 (GRCm39) F130L probably damaging Het
Nemf A T 12: 69,402,826 (GRCm39) M70K possibly damaging Het
Nploc4 A G 11: 120,280,240 (GRCm39) I436T possibly damaging Het
Obscn C A 11: 59,015,439 (GRCm39) R1011M probably damaging Het
Or4k44 A T 2: 111,367,825 (GRCm39) F270I probably damaging Het
Or5aq1b T C 2: 86,901,570 (GRCm39) K303E probably benign Het
Or8k24 T A 2: 86,215,911 (GRCm39) M284L probably benign Het
Ormdl1 T A 1: 53,338,139 (GRCm39) M1K probably null Het
Pramel34 A T 5: 93,784,597 (GRCm39) L289Q probably damaging Het
Psmb3 A G 11: 97,594,723 (GRCm39) D38G probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Slc22a18 G A 7: 143,052,911 (GRCm39) V379I probably damaging Het
Speg T A 1: 75,392,240 (GRCm39) F1632L probably damaging Het
Taok1 G A 11: 77,470,659 (GRCm39) R49C possibly damaging Het
Ttll6 T C 11: 96,047,425 (GRCm39) S675P probably benign Het
Usp8 A T 2: 126,559,918 (GRCm39) probably benign Het
Vmn2r81 T A 10: 79,110,538 (GRCm39) N550K possibly damaging Het
Zfp119a A T 17: 56,172,971 (GRCm39) C291S probably damaging Het
Zfp329 C A 7: 12,544,313 (GRCm39) G404C probably damaging Het
Zfp934 C A 13: 62,667,985 (GRCm39) probably null Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTGTGCAGGGTTTCACAC -3'
(R):5'- ATGCCCAATCATTCCTTTCAAG -3'

Sequencing Primer
(F):5'- ACACCTGTGATTCCAGTTCTCAGAAG -3'
(R):5'- GCCCAATCATTCCTTTCAAGATATTG -3'
Posted On 2020-06-30