Incidental Mutation 'R8130:Nemf'
ID 631990
Institutional Source Beutler Lab
Gene Symbol Nemf
Ensembl Gene ENSMUSG00000020982
Gene Name nuclear export mediator factor
Synonyms 1500011I12Rik, 4933405E14Rik, Sdccag1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8130 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 69310522-69357165 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69356052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 70 (M70K)
Ref Sequence ENSEMBL: ENSMUSP00000021368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021368] [ENSMUST00000220484] [ENSMUST00000222065]
AlphaFold Q8CCP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000021368
AA Change: M70K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982
AA Change: M70K

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220484
AA Change: M70K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably damaging
Transcript: ENSMUST00000222065
AA Change: M70K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.1738 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the ribosome quality control complex. The encoded protein facilitates the recognition and ubiquitination of stalled 60S subunits by the ubiquitin ligase listerin. A similar protein in fly functions as a tumor suppressor. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,563,009 I130M probably damaging Het
4921539E11Rik T C 4: 103,235,698 D142G probably damaging Het
4931428F04Rik G A 8: 105,285,513 R101W probably benign Het
Abcb10 C T 8: 123,965,018 A403T Het
Arfgef2 T A 2: 166,836,250 S218T possibly damaging Het
Armc8 C T 9: 99,551,547 V40I probably benign Het
C87414 A T 5: 93,636,738 L289Q probably damaging Het
Caps2 A T 10: 112,182,476 D177V probably benign Het
Cdh8 A T 8: 99,031,044 F641I probably damaging Het
Cemip T C 7: 83,947,176 S1127G probably benign Het
Cmtm1 C A 8: 104,309,456 Q180H unknown Het
Col15a1 C T 4: 47,312,196 T1337I probably damaging Het
Col18a1 A T 10: 77,074,450 M555K probably benign Het
Ctrb1 A G 8: 111,689,191 F89L possibly damaging Het
Disp1 T C 1: 183,135,635 T76A probably benign Het
Dpep1 T C 8: 123,200,226 V263A probably damaging Het
Dysf G A 6: 84,137,376 E1216K probably damaging Het
F830016B08Rik A G 18: 60,299,980 Y45C probably benign Het
Fam186a CGG CG 15: 99,944,033 probably null Het
Gcm1 T A 9: 78,064,534 D252E probably benign Het
Gm11559 A G 11: 99,864,590 T22A unknown Het
Gm4847 C T 1: 166,638,348 R224Q probably damaging Het
Gm4869 C T 5: 140,474,961 R461C probably damaging Het
Hypk A G 2: 121,456,378 probably benign Het
I830077J02Rik C T 3: 105,926,917 C64Y possibly damaging Het
Igkv4-86 T C 6: 68,910,666 I30V probably benign Het
Il17ra A G 6: 120,478,455 I342V probably benign Het
Kcnip3 C T 2: 127,510,908 A64T possibly damaging Het
Kdm5d T A Y: 940,658 D1056E possibly damaging Het
Krtap19-2 C T 16: 88,874,015 G81R unknown Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lpin1 A T 12: 16,579,964 I69N Het
Mki67 C T 7: 135,697,564 D1914N probably damaging Het
Mmrn1 A T 6: 60,960,723 Q235L probably damaging Het
Mndal T A 1: 173,871,545 K185* probably null Het
Muc6 T C 7: 141,647,087 T802A probably damaging Het
Necab1 A T 4: 15,005,073 F130L probably damaging Het
Nploc4 A G 11: 120,389,414 I436T possibly damaging Het
Obscn C A 11: 59,124,613 R1011M probably damaging Het
Olfr1058 T A 2: 86,385,567 M284L probably benign Het
Olfr1107 T C 2: 87,071,226 K303E probably benign Het
Olfr1294 A T 2: 111,537,480 F270I probably damaging Het
Ormdl1 T A 1: 53,298,980 M1K probably null Het
Psmb3 A G 11: 97,703,897 D38G probably benign Het
Psme4 T A 11: 30,842,026 L1171Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Slc22a18 G A 7: 143,499,174 V379I probably damaging Het
Speg T A 1: 75,415,596 F1632L probably damaging Het
Taok1 G A 11: 77,579,833 R49C possibly damaging Het
Ttll6 T C 11: 96,156,599 S675P probably benign Het
Usp8 A T 2: 126,717,998 probably benign Het
Vmn2r81 T A 10: 79,274,704 N550K possibly damaging Het
Zfp119a A T 17: 55,865,971 C291S probably damaging Het
Zfp329 C A 7: 12,810,386 G404C probably damaging Het
Zfp934 C A 13: 62,520,171 probably null Het
Other mutations in Nemf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Nemf APN 12 69344986 splice site probably benign
IGL02499:Nemf APN 12 69322129 missense probably damaging 1.00
IGL03352:Nemf APN 12 69331905 missense probably damaging 1.00
kaempfer UTSW 12 69352336 missense probably benign 0.01
R0335:Nemf UTSW 12 69353803 missense probably benign 0.16
R0538:Nemf UTSW 12 69356314 missense probably damaging 1.00
R0581:Nemf UTSW 12 69322271 missense probably benign
R0909:Nemf UTSW 12 69341610 missense probably damaging 1.00
R1792:Nemf UTSW 12 69312569 missense probably damaging 1.00
R1899:Nemf UTSW 12 69346378 missense probably null
R2080:Nemf UTSW 12 69353786 splice site probably benign
R3704:Nemf UTSW 12 69331130 missense probably damaging 1.00
R3842:Nemf UTSW 12 69331949 missense probably damaging 0.98
R4471:Nemf UTSW 12 69314442 missense probably benign 0.04
R4666:Nemf UTSW 12 69312280 missense probably damaging 1.00
R4720:Nemf UTSW 12 69324288 missense probably benign 0.05
R5198:Nemf UTSW 12 69356047 missense probably damaging 1.00
R5474:Nemf UTSW 12 69316335 missense probably benign 0.03
R6893:Nemf UTSW 12 69352336 missense probably benign 0.01
R7008:Nemf UTSW 12 69341621 missense possibly damaging 0.91
R7008:Nemf UTSW 12 69353793 critical splice donor site probably null
R7098:Nemf UTSW 12 69312467 missense probably damaging 1.00
R7154:Nemf UTSW 12 69316741 critical splice donor site probably null
R7452:Nemf UTSW 12 69337959 splice site probably null
R8340:Nemf UTSW 12 69353885 missense possibly damaging 0.94
R8914:Nemf UTSW 12 69316315 nonsense probably null
R9089:Nemf UTSW 12 69353854 missense probably damaging 1.00
R9150:Nemf UTSW 12 69341046 missense probably benign 0.00
R9228:Nemf UTSW 12 69341319 missense probably damaging 1.00
R9644:Nemf UTSW 12 69312662 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCAGCAGATTAAGGCACATGG -3'
(R):5'- CTTGCTAGGAATGAGAGTAAACAAC -3'

Sequencing Primer
(F):5'- TTCCAGGTCAGCAGATTAAGGCAC -3'
(R):5'- GGATAACAAGACATATCTTATTCGGC -3'
Posted On 2020-06-30