Incidental Mutation 'R8131:Cyp2b10'
ID 632011
Institutional Source Beutler Lab
Gene Symbol Cyp2b10
Ensembl Gene ENSMUSG00000030483
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms phenobarbitol inducible, type b, p16, Cyp2b20, Cyp2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8131 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 25897620-25926624 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 25914817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 239 (Q239*)
Ref Sequence ENSEMBL: ENSMUSP00000005477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005477] [ENSMUST00000072438]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000005477
AA Change: Q239*
SMART Domains Protein: ENSMUSP00000005477
Gene: ENSMUSG00000030483
AA Change: Q239*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 497 4.1e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072438
AA Change: Q239*
SMART Domains Protein: ENSMUSP00000072264
Gene: ENSMUSG00000030483
AA Change: Q239*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2e-152 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A G 11: 70,616,008 probably null Het
Abcb10 C T 8: 123,965,018 A403T Het
Acan C T 7: 79,091,338 P484L possibly damaging Het
Amotl2 T A 9: 102,720,416 Y125N probably damaging Het
Apaf1 C A 10: 91,077,558 V168F possibly damaging Het
Arhgap32 C T 9: 32,247,130 H154Y probably damaging Het
B4galnt3 A G 6: 120,294,385 probably null Het
Bahcc1 C T 11: 120,272,838 A654V probably benign Het
BC005561 A G 5: 104,521,161 E1183G possibly damaging Het
Bcl11b T A 12: 107,965,708 M202L probably benign Het
Cdc40 C A 10: 40,841,477 R406L possibly damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Col26a1 T C 5: 136,747,040 D353G probably benign Het
Col6a5 T A 9: 105,901,616 Q1682L unknown Het
Cul9 C T 17: 46,511,242 G1819D probably damaging Het
Dthd1 T A 5: 62,842,916 I527N probably damaging Het
Dzip3 C T 16: 48,933,793 probably null Het
Ecm2 A G 13: 49,518,464 E147G probably benign Het
Ercc6l2 C T 13: 63,834,747 T132M probably damaging Het
Esf1 G A 2: 140,148,831 Q578* probably null Het
Gm15448 T A 7: 3,822,162 R494* probably null Het
Gria4 C T 9: 4,502,429 R368H probably benign Het
Hps5 T C 7: 46,771,888 D717G probably benign Het
Hrh1 A T 6: 114,480,292 D178V probably benign Het
Inppl1 T C 7: 101,830,061 N537S possibly damaging Het
Itih1 T C 14: 30,941,564 Y165C probably damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Larp4 T C 15: 99,994,689 V255A probably damaging Het
Lrriq1 T G 10: 103,215,711 R393S possibly damaging Het
Mep1a T A 17: 43,502,667 I31L probably benign Het
Muc5b C T 7: 141,842,409 T134I unknown Het
Neurl4 T C 11: 69,909,241 Y1052H probably benign Het
Nlrc5 C G 8: 94,481,792 N755K probably damaging Het
Nrde2 T C 12: 100,142,243 K363R probably benign Het
Pcdhb12 T C 18: 37,437,282 S494P possibly damaging Het
Pcnx C A 12: 81,918,518 S486R possibly damaging Het
Plrg1 T A 3: 83,069,774 V374E probably damaging Het
Plxnb2 A G 15: 89,158,713 I1491T probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn4a T C 11: 106,341,541 E490G probably benign Het
Sec16a A G 2: 26,410,946 V887A Het
Serpina3a T C 12: 104,116,208 I80T probably damaging Het
Setd1b A T 5: 123,143,380 I66F unknown Het
Slirp T A 12: 87,447,658 probably null Het
Socs6 A C 18: 88,870,045 S249A probably benign Het
Ttn A T 2: 76,785,733 I16622N probably damaging Het
Uox A T 3: 146,625,834 T237S probably damaging Het
Vmn2r43 T A 7: 8,255,327 I296L probably benign Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vps13b T C 15: 35,372,109 probably null Het
Vps13d A G 4: 145,156,137 V962A Het
Other mutations in Cyp2b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Cyp2b10 APN 7 25913937 missense probably damaging 0.99
IGL02341:Cyp2b10 APN 7 25911242 missense probably benign 0.33
IGL02557:Cyp2b10 APN 7 25914881 missense probably benign
R0038:Cyp2b10 UTSW 7 25914862 missense probably benign 0.21
R0393:Cyp2b10 UTSW 7 25914934 splice site probably benign
R0569:Cyp2b10 UTSW 7 25897735 missense probably damaging 1.00
R1035:Cyp2b10 UTSW 7 25917048 missense probably benign 0.34
R1262:Cyp2b10 UTSW 7 25915411 missense probably benign 0.16
R1282:Cyp2b10 UTSW 7 25926080 missense probably damaging 1.00
R1452:Cyp2b10 UTSW 7 25925388 intron probably benign
R2163:Cyp2b10 UTSW 7 25925385 intron probably benign
R4520:Cyp2b10 UTSW 7 25911557 missense probably benign 0.05
R4831:Cyp2b10 UTSW 7 25915496 nonsense probably null
R5201:Cyp2b10 UTSW 7 25916994 missense probably damaging 1.00
R5330:Cyp2b10 UTSW 7 25913989 nonsense probably null
R5586:Cyp2b10 UTSW 7 25917012 missense probably damaging 1.00
R5964:Cyp2b10 UTSW 7 25926223 missense probably benign 0.28
R6043:Cyp2b10 UTSW 7 25917339 missense probably damaging 0.99
R6470:Cyp2b10 UTSW 7 25911656 missense possibly damaging 0.57
R6991:Cyp2b10 UTSW 7 25917355 missense probably benign 0.05
R7567:Cyp2b10 UTSW 7 25914779 missense probably damaging 1.00
R7847:Cyp2b10 UTSW 7 25897760 missense possibly damaging 0.52
R8486:Cyp2b10 UTSW 7 25914881 missense probably benign
R8988:Cyp2b10 UTSW 7 25926245 missense probably damaging 1.00
R8992:Cyp2b10 UTSW 7 25925390 missense unknown
R9286:Cyp2b10 UTSW 7 25916966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGTCTGATAGGATGCTGTG -3'
(R):5'- GTGTTTCTTTCCCAGCCACA -3'

Sequencing Primer
(F):5'- TGTATGTGCATCAGAGCGAAAGTG -3'
(R):5'- GTTCTTTATTTTCCAGATGTTCTGC -3'
Posted On 2020-06-30