Incidental Mutation 'R8131:Cdc40'
ID632023
Institutional Source Beutler Lab
Gene Symbol Cdc40
Ensembl Gene ENSMUSG00000038446
Gene Namecell division cycle 40
SynonymsPRP17, 1200003H23Rik, EHB3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R8131 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40831621-40883311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40841477 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 406 (R406L)
Ref Sequence ENSEMBL: ENSMUSP00000044305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044166
AA Change: R406L

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044305
Gene: ENSMUSG00000038446
AA Change: R406L

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
WD40 277 317 6.04e-8 SMART
WD40 321 360 8.1e-9 SMART
WD40 363 404 1.58e-2 SMART
WD40 407 446 9.52e-6 SMART
WD40 452 489 2.13e1 SMART
WD40 495 536 1.4e-3 SMART
WD40 539 579 3.37e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp17 protein, which functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. It suggests that this protein may play a role in cell cycle progression. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A G 11: 70,616,008 probably null Het
Abcb10 C T 8: 123,965,018 A403T Het
Acan C T 7: 79,091,338 P484L possibly damaging Het
Amotl2 T A 9: 102,720,416 Y125N probably damaging Het
Apaf1 C A 10: 91,077,558 V168F possibly damaging Het
Arhgap32 C T 9: 32,247,130 H154Y probably damaging Het
B4galnt3 A G 6: 120,294,385 probably null Het
Bahcc1 C T 11: 120,272,838 A654V probably benign Het
BC005561 A G 5: 104,521,161 E1183G possibly damaging Het
Bcl11b T A 12: 107,965,708 M202L probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Col26a1 T C 5: 136,747,040 D353G probably benign Het
Col6a5 T A 9: 105,901,616 Q1682L unknown Het
Cul9 C T 17: 46,511,242 G1819D probably damaging Het
Cyp2b10 C T 7: 25,914,817 Q239* probably null Het
Dthd1 T A 5: 62,842,916 I527N probably damaging Het
Dzip3 C T 16: 48,933,793 probably null Het
Ecm2 A G 13: 49,518,464 E147G probably benign Het
Ercc6l2 C T 13: 63,834,747 T132M probably damaging Het
Esf1 G A 2: 140,148,831 Q578* probably null Het
Gm15448 T A 7: 3,822,162 R494* probably null Het
Gria4 C T 9: 4,502,429 R368H probably benign Het
Hps5 T C 7: 46,771,888 D717G probably benign Het
Hrh1 A T 6: 114,480,292 D178V probably benign Het
Inppl1 T C 7: 101,830,061 N537S possibly damaging Het
Itih1 T C 14: 30,941,564 Y165C probably damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Larp4 T C 15: 99,994,689 V255A probably damaging Het
Lrriq1 T G 10: 103,215,711 R393S possibly damaging Het
Mep1a T A 17: 43,502,667 I31L probably benign Het
Muc5b C T 7: 141,842,409 T134I unknown Het
Neurl4 T C 11: 69,909,241 Y1052H probably benign Het
Nlrc5 C G 8: 94,481,792 N755K probably damaging Het
Nrde2 T C 12: 100,142,243 K363R probably benign Het
Pcdhb12 T C 18: 37,437,282 S494P possibly damaging Het
Pcnx C A 12: 81,918,518 S486R possibly damaging Het
Plrg1 T A 3: 83,069,774 V374E probably damaging Het
Plxnb2 A G 15: 89,158,713 I1491T probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn4a T C 11: 106,341,541 E490G probably benign Het
Sec16a A G 2: 26,410,946 V887A Het
Serpina3a T C 12: 104,116,208 I80T probably damaging Het
Setd1b A T 5: 123,143,380 I66F unknown Het
Slirp T A 12: 87,447,658 probably null Het
Socs6 A C 18: 88,870,045 S249A probably benign Het
Ttn A T 2: 76,785,733 I16622N probably damaging Het
Uox A T 3: 146,625,834 T237S probably damaging Het
Vmn2r43 T A 7: 8,255,327 I296L probably benign Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vps13b T C 15: 35,372,109 probably null Het
Vps13d A G 4: 145,156,137 V962A Het
Other mutations in Cdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cdc40 APN 10 40843128 missense probably damaging 1.00
IGL02333:Cdc40 APN 10 40867859 missense probably benign 0.00
IGL02490:Cdc40 APN 10 40841771 missense probably benign 0.39
IGL02878:Cdc40 APN 10 40843122 missense probably damaging 0.96
IGL02976:Cdc40 APN 10 40882921 missense probably benign
IGL03058:Cdc40 APN 10 40849828 missense probably benign 0.01
IGL03178:Cdc40 APN 10 40847989 missense probably benign
R0409:Cdc40 UTSW 10 40847168 missense probably damaging 0.99
R0522:Cdc40 UTSW 10 40857612 missense probably benign 0.21
R0608:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R0730:Cdc40 UTSW 10 40844956 splice site probably benign
R1712:Cdc40 UTSW 10 40841376 missense probably damaging 1.00
R1940:Cdc40 UTSW 10 40883071 unclassified probably benign
R4062:Cdc40 UTSW 10 40849852 splice site probably null
R5035:Cdc40 UTSW 10 40849813 missense probably benign 0.18
R5628:Cdc40 UTSW 10 40851053 missense probably benign 0.03
R6933:Cdc40 UTSW 10 40844996 missense probably damaging 0.96
R7082:Cdc40 UTSW 10 40867873 missense probably benign
R7419:Cdc40 UTSW 10 40841443 missense probably damaging 1.00
R7625:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R7834:Cdc40 UTSW 10 40882949 missense probably benign 0.00
R7908:Cdc40 UTSW 10 40848046 missense probably damaging 1.00
R8031:Cdc40 UTSW 10 40852516 missense probably benign 0.00
RF041:Cdc40 UTSW 10 40843123 missense probably damaging 1.00
X0026:Cdc40 UTSW 10 40841452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACACTTTGGTTGGAAGACATG -3'
(R):5'- AGATTGTTGATGTCTGCCCC -3'

Sequencing Primer
(F):5'- GCTGCATATTATCAAGCTTCGG -3'
(R):5'- TGATGTCTGCCCCTCTGAGG -3'
Posted On2020-06-30