Incidental Mutation 'R8131:Scn4a'
ID632027
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8131 (G1)
Quality Score161.009
Status Not validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106341541 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 490 (E490G)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably benign
Transcript: ENSMUST00000021056
AA Change: E490G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: E490G

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Acan C T 7: 79,091,338 P484L possibly damaging Het
Apaf1 C A 10: 91,077,558 V168F possibly damaging Het
Arhgap32 C T 9: 32,247,130 H154Y probably damaging Het
Bahcc1 C T 11: 120,272,838 A654V probably benign Het
BC005561 A G 5: 104,521,161 E1183G possibly damaging Het
Bcl11b T A 12: 107,965,708 M202L probably benign Het
Cdc40 C A 10: 40,841,477 R406L possibly damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Col26a1 T C 5: 136,747,040 D353G probably benign Het
Col6a5 T A 9: 105,901,616 Q1682L unknown Het
Cul9 C T 17: 46,511,242 G1819D probably damaging Het
Cyp2b10 C T 7: 25,914,817 Q239* probably null Het
Dthd1 T A 5: 62,842,916 I527N probably damaging Het
Dzip3 C T 16: 48,933,793 probably null Het
Ecm2 A G 13: 49,518,464 E147G probably benign Het
Ercc6l2 C T 13: 63,834,747 T132M probably damaging Het
Esf1 G A 2: 140,148,831 Q578* probably null Het
Gm15448 T A 7: 3,822,162 R494* probably null Het
Gria4 C T 9: 4,502,429 R368H probably benign Het
Hps5 T C 7: 46,771,888 D717G probably benign Het
Hrh1 A T 6: 114,480,292 D178V probably benign Het
Inppl1 T C 7: 101,830,061 N537S possibly damaging Het
Itih1 T C 14: 30,941,564 Y165C probably damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Larp4 T C 15: 99,994,689 V255A probably damaging Het
Lrriq1 T G 10: 103,215,711 R393S possibly damaging Het
Mep1a T A 17: 43,502,667 I31L probably benign Het
Muc5b C T 7: 141,842,409 T134I unknown Het
Neurl4 T C 11: 69,909,241 Y1052H probably benign Het
Nlrc5 C G 8: 94,481,792 N755K probably damaging Het
Nrde2 T C 12: 100,142,243 K363R probably benign Het
Pcdhb12 T C 18: 37,437,282 S494P possibly damaging Het
Pcnx C A 12: 81,918,518 S486R possibly damaging Het
Plrg1 T A 3: 83,069,774 V374E probably damaging Het
Plxnb2 A G 15: 89,158,713 I1491T probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sec16a A G 2: 26,410,946 V887A Het
Serpina3a T C 12: 104,116,208 I80T probably damaging Het
Setd1b A T 5: 123,143,380 I66F unknown Het
Socs6 A C 18: 88,870,045 S249A probably benign Het
Ttn A T 2: 76,785,733 I16622N probably damaging Het
Uox A T 3: 146,625,834 T237S probably damaging Het
Vmn2r43 T A 7: 8,255,327 I296L probably benign Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vps13b T C 15: 35,372,109 probably null Het
Vps13d A G 4: 145,156,137 V962A Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGAAACTGGGTCCAAGC -3'
(R):5'- TGCCTCAAAGTGAAATCTCCTTC -3'

Sequencing Primer
(F):5'- CCTACAGCTCAGGAGGCTAAG -3'
(R):5'- ATGTGAGTACACTGTCACTGTC -3'
Posted On2020-06-30