Incidental Mutation 'R8131:Serpina3a'
ID632031
Institutional Source Beutler Lab
Gene Symbol Serpina3a
Ensembl Gene ENSMUSG00000041536
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8131 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104112724-104121896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104116208 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 80 (I80T)
Ref Sequence ENSEMBL: ENSMUSP00000140024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021496] [ENSMUST00000109965] [ENSMUST00000185595]
Predicted Effect probably damaging
Transcript: ENSMUST00000021496
AA Change: I80T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021496
Gene: ENSMUSG00000041536
AA Change: I80T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109965
SMART Domains Protein: ENSMUSP00000105591
Gene: ENSMUSG00000041536

DomainStartEndE-ValueType
SERPIN 4 229 5.39e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185595
AA Change: I80T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140024
Gene: ENSMUSG00000041536
AA Change: I80T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A G 11: 70,616,008 probably null Het
Abcb10 C T 8: 123,965,018 A403T Het
Acan C T 7: 79,091,338 P484L possibly damaging Het
Amotl2 T A 9: 102,720,416 Y125N probably damaging Het
Apaf1 C A 10: 91,077,558 V168F possibly damaging Het
Arhgap32 C T 9: 32,247,130 H154Y probably damaging Het
B4galnt3 A G 6: 120,294,385 probably null Het
Bahcc1 C T 11: 120,272,838 A654V probably benign Het
BC005561 A G 5: 104,521,161 E1183G possibly damaging Het
Bcl11b T A 12: 107,965,708 M202L probably benign Het
Cdc40 C A 10: 40,841,477 R406L possibly damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Col26a1 T C 5: 136,747,040 D353G probably benign Het
Col6a5 T A 9: 105,901,616 Q1682L unknown Het
Cul9 C T 17: 46,511,242 G1819D probably damaging Het
Cyp2b10 C T 7: 25,914,817 Q239* probably null Het
Dthd1 T A 5: 62,842,916 I527N probably damaging Het
Dzip3 C T 16: 48,933,793 probably null Het
Ecm2 A G 13: 49,518,464 E147G probably benign Het
Ercc6l2 C T 13: 63,834,747 T132M probably damaging Het
Esf1 G A 2: 140,148,831 Q578* probably null Het
Gm15448 T A 7: 3,822,162 R494* probably null Het
Gria4 C T 9: 4,502,429 R368H probably benign Het
Hps5 T C 7: 46,771,888 D717G probably benign Het
Hrh1 A T 6: 114,480,292 D178V probably benign Het
Inppl1 T C 7: 101,830,061 N537S possibly damaging Het
Itih1 T C 14: 30,941,564 Y165C probably damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Larp4 T C 15: 99,994,689 V255A probably damaging Het
Lrriq1 T G 10: 103,215,711 R393S possibly damaging Het
Mep1a T A 17: 43,502,667 I31L probably benign Het
Muc5b C T 7: 141,842,409 T134I unknown Het
Neurl4 T C 11: 69,909,241 Y1052H probably benign Het
Nlrc5 C G 8: 94,481,792 N755K probably damaging Het
Nrde2 T C 12: 100,142,243 K363R probably benign Het
Pcdhb12 T C 18: 37,437,282 S494P possibly damaging Het
Pcnx C A 12: 81,918,518 S486R possibly damaging Het
Plrg1 T A 3: 83,069,774 V374E probably damaging Het
Plxnb2 A G 15: 89,158,713 I1491T probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn4a T C 11: 106,341,541 E490G probably benign Het
Sec16a A G 2: 26,410,946 V887A Het
Setd1b A T 5: 123,143,380 I66F unknown Het
Slirp T A 12: 87,447,658 probably null Het
Socs6 A C 18: 88,870,045 S249A probably benign Het
Ttn A T 2: 76,785,733 I16622N probably damaging Het
Uox A T 3: 146,625,834 T237S probably damaging Het
Vmn2r43 T A 7: 8,255,327 I296L probably benign Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vps13b T C 15: 35,372,109 probably null Het
Vps13d A G 4: 145,156,137 V962A Het
Other mutations in Serpina3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Serpina3a APN 12 104121499 missense probably benign 0.05
IGL02003:Serpina3a APN 12 104116000 missense probably benign 0.02
IGL02379:Serpina3a APN 12 104118660 missense probably benign 0.00
IGL02547:Serpina3a APN 12 104116543 missense probably damaging 0.98
IGL02593:Serpina3a APN 12 104118432 missense probably benign 0.01
IGL02730:Serpina3a APN 12 104119663 missense probably damaging 1.00
IGL02953:Serpina3a APN 12 104116489 missense probably benign 0.00
IGL03197:Serpina3a APN 12 104116241 missense probably damaging 1.00
R1184:Serpina3a UTSW 12 104116528 nonsense probably null
R1635:Serpina3a UTSW 12 104116478 missense probably damaging 1.00
R1688:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R1804:Serpina3a UTSW 12 104118416 splice site probably benign
R1867:Serpina3a UTSW 12 104118627 missense probably benign 0.01
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R2110:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2111:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2305:Serpina3a UTSW 12 104116528 missense probably benign 0.05
R2326:Serpina3a UTSW 12 104116499 missense probably benign 0.01
R2405:Serpina3a UTSW 12 104121318 missense possibly damaging 0.50
R4008:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4010:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4011:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4079:Serpina3a UTSW 12 104119675 nonsense probably null
R4091:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4092:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4210:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R5064:Serpina3a UTSW 12 104116189 missense probably benign 0.01
R6242:Serpina3a UTSW 12 104116001 missense probably benign 0.10
R6337:Serpina3a UTSW 12 104112878 missense probably benign 0.36
R6395:Serpina3a UTSW 12 104116451 missense probably damaging 0.99
R6683:Serpina3a UTSW 12 104119637 missense probably benign 0.16
R6994:Serpina3a UTSW 12 104112830 splice site probably null
R7117:Serpina3a UTSW 12 104116177 missense possibly damaging 0.95
R8104:Serpina3a UTSW 12 104112851 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATCACCTACTGGGCAACTGC -3'
(R):5'- TGTCAAGATCTGCAGGTGCTTATC -3'

Sequencing Primer
(F):5'- ACCTACTGGGCAACTGCAGATG -3'
(R):5'- GCTTATCAATAAACAGGGCGTTGC -3'
Posted On2020-06-30