Incidental Mutation 'R8131:Larp4'
ID632038
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene NameLa ribonucleoprotein domain family, member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R8131 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99970065-100016358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99994689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 255 (V255A)
Ref Sequence ENSEMBL: ENSMUSP00000097780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206] [ENSMUST00000230521] [ENSMUST00000230956] [ENSMUST00000231160]
Predicted Effect probably damaging
Transcript: ENSMUST00000057632
AA Change: V254A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025
AA Change: V254A

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100206
AA Change: V255A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025
AA Change: V255A

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230521
Predicted Effect possibly damaging
Transcript: ENSMUST00000230956
AA Change: V256A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000231160
AA Change: V196A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A G 11: 70,616,008 probably null Het
Abcb10 C T 8: 123,965,018 A403T Het
Acan C T 7: 79,091,338 P484L possibly damaging Het
Amotl2 T A 9: 102,720,416 Y125N probably damaging Het
Apaf1 C A 10: 91,077,558 V168F possibly damaging Het
Arhgap32 C T 9: 32,247,130 H154Y probably damaging Het
B4galnt3 A G 6: 120,294,385 probably null Het
Bahcc1 C T 11: 120,272,838 A654V probably benign Het
BC005561 A G 5: 104,521,161 E1183G possibly damaging Het
Bcl11b T A 12: 107,965,708 M202L probably benign Het
Cdc40 C A 10: 40,841,477 R406L possibly damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Col26a1 T C 5: 136,747,040 D353G probably benign Het
Col6a5 T A 9: 105,901,616 Q1682L unknown Het
Cul9 C T 17: 46,511,242 G1819D probably damaging Het
Cyp2b10 C T 7: 25,914,817 Q239* probably null Het
Dthd1 T A 5: 62,842,916 I527N probably damaging Het
Dzip3 C T 16: 48,933,793 probably null Het
Ecm2 A G 13: 49,518,464 E147G probably benign Het
Ercc6l2 C T 13: 63,834,747 T132M probably damaging Het
Esf1 G A 2: 140,148,831 Q578* probably null Het
Gm15448 T A 7: 3,822,162 R494* probably null Het
Gria4 C T 9: 4,502,429 R368H probably benign Het
Hps5 T C 7: 46,771,888 D717G probably benign Het
Hrh1 A T 6: 114,480,292 D178V probably benign Het
Inppl1 T C 7: 101,830,061 N537S possibly damaging Het
Itih1 T C 14: 30,941,564 Y165C probably damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Lrriq1 T G 10: 103,215,711 R393S possibly damaging Het
Mep1a T A 17: 43,502,667 I31L probably benign Het
Muc5b C T 7: 141,842,409 T134I unknown Het
Neurl4 T C 11: 69,909,241 Y1052H probably benign Het
Nlrc5 C G 8: 94,481,792 N755K probably damaging Het
Nrde2 T C 12: 100,142,243 K363R probably benign Het
Pcdhb12 T C 18: 37,437,282 S494P possibly damaging Het
Pcnx C A 12: 81,918,518 S486R possibly damaging Het
Plrg1 T A 3: 83,069,774 V374E probably damaging Het
Plxnb2 A G 15: 89,158,713 I1491T probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn4a T C 11: 106,341,541 E490G probably benign Het
Sec16a A G 2: 26,410,946 V887A Het
Serpina3a T C 12: 104,116,208 I80T probably damaging Het
Setd1b A T 5: 123,143,380 I66F unknown Het
Slirp T A 12: 87,447,658 probably null Het
Socs6 A C 18: 88,870,045 S249A probably benign Het
Ttn A T 2: 76,785,733 I16622N probably damaging Het
Uox A T 3: 146,625,834 T237S probably damaging Het
Vmn2r43 T A 7: 8,255,327 I296L probably benign Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vps13b T C 15: 35,372,109 probably null Het
Vps13d A G 4: 145,156,137 V962A Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99987421 missense probably damaging 0.98
IGL01668:Larp4 APN 15 99987474 missense probably damaging 1.00
IGL01687:Larp4 APN 15 99996488 missense probably damaging 1.00
IGL02105:Larp4 APN 15 99986071 missense probably damaging 1.00
IGL02676:Larp4 APN 15 99990421 missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99986086 missense probably damaging 1.00
Skewer UTSW 15 100007730 critical splice donor site probably null
R1076:Larp4 UTSW 15 99997430 missense probably benign 0.00
R1996:Larp4 UTSW 15 99984963 missense probably damaging 1.00
R2183:Larp4 UTSW 15 100011897 missense probably benign 0.16
R2260:Larp4 UTSW 15 99997396 missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99990357 missense probably damaging 1.00
R3916:Larp4 UTSW 15 99990403 missense probably benign 0.00
R3962:Larp4 UTSW 15 100012145 missense probably damaging 1.00
R5059:Larp4 UTSW 15 100005290 missense probably damaging 1.00
R5081:Larp4 UTSW 15 99973017 intron probably benign
R5104:Larp4 UTSW 15 99986083 missense probably damaging 1.00
R5409:Larp4 UTSW 15 99986064 missense probably damaging 0.98
R5436:Larp4 UTSW 15 99986114 missense probably damaging 0.98
R6895:Larp4 UTSW 15 100007730 critical splice donor site probably null
R7316:Larp4 UTSW 15 100001017 missense probably benign
R7483:Larp4 UTSW 15 99991778 missense probably benign 0.01
R7510:Larp4 UTSW 15 99993377 missense probably benign 0.07
R8263:Larp4 UTSW 15 99986080 missense probably benign 0.00
R8322:Larp4 UTSW 15 100010356 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGCCTTGCTGTGTCCAAG -3'
(R):5'- ATTCCTGCTACTGAGACAGGG -3'

Sequencing Primer
(F):5'- GCTGTGTCCAAGGCTGG -3'
(R):5'- TTTCTGAAGTAGGACAACAATGC -3'
Posted On2020-06-30