Incidental Mutation 'R8131:Mep1a'
ID 632041
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Name meprin 1 alpha
Synonyms Mep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8131 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 43474324-43502812 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43502667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 31 (I31L)
Ref Sequence ENSEMBL: ENSMUSP00000024707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
AlphaFold P28825
Predicted Effect probably benign
Transcript: ENSMUST00000024707
AA Change: I31L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: I31L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117137
AA Change: I18L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: I18L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik A G 11: 70,616,008 probably null Het
Abcb10 C T 8: 123,965,018 A403T Het
Acan C T 7: 79,091,338 P484L possibly damaging Het
Amotl2 T A 9: 102,720,416 Y125N probably damaging Het
Apaf1 C A 10: 91,077,558 V168F possibly damaging Het
Arhgap32 C T 9: 32,247,130 H154Y probably damaging Het
B4galnt3 A G 6: 120,294,385 probably null Het
Bahcc1 C T 11: 120,272,838 A654V probably benign Het
BC005561 A G 5: 104,521,161 E1183G possibly damaging Het
Bcl11b T A 12: 107,965,708 M202L probably benign Het
Cdc40 C A 10: 40,841,477 R406L possibly damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Col26a1 T C 5: 136,747,040 D353G probably benign Het
Col6a5 T A 9: 105,901,616 Q1682L unknown Het
Cul9 C T 17: 46,511,242 G1819D probably damaging Het
Cyp2b10 C T 7: 25,914,817 Q239* probably null Het
Dthd1 T A 5: 62,842,916 I527N probably damaging Het
Dzip3 C T 16: 48,933,793 probably null Het
Ecm2 A G 13: 49,518,464 E147G probably benign Het
Ercc6l2 C T 13: 63,834,747 T132M probably damaging Het
Esf1 G A 2: 140,148,831 Q578* probably null Het
Gm15448 T A 7: 3,822,162 R494* probably null Het
Gria4 C T 9: 4,502,429 R368H probably benign Het
Hps5 T C 7: 46,771,888 D717G probably benign Het
Hrh1 A T 6: 114,480,292 D178V probably benign Het
Inppl1 T C 7: 101,830,061 N537S possibly damaging Het
Itih1 T C 14: 30,941,564 Y165C probably damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Larp4 T C 15: 99,994,689 V255A probably damaging Het
Lrriq1 T G 10: 103,215,711 R393S possibly damaging Het
Muc5b C T 7: 141,842,409 T134I unknown Het
Neurl4 T C 11: 69,909,241 Y1052H probably benign Het
Nlrc5 C G 8: 94,481,792 N755K probably damaging Het
Nrde2 T C 12: 100,142,243 K363R probably benign Het
Pcdhb12 T C 18: 37,437,282 S494P possibly damaging Het
Pcnx C A 12: 81,918,518 S486R possibly damaging Het
Plrg1 T A 3: 83,069,774 V374E probably damaging Het
Plxnb2 A G 15: 89,158,713 I1491T probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn4a T C 11: 106,341,541 E490G probably benign Het
Sec16a A G 2: 26,410,946 V887A Het
Serpina3a T C 12: 104,116,208 I80T probably damaging Het
Setd1b A T 5: 123,143,380 I66F unknown Het
Slirp T A 12: 87,447,658 probably null Het
Socs6 A C 18: 88,870,045 S249A probably benign Het
Ttn A T 2: 76,785,733 I16622N probably damaging Het
Uox A T 3: 146,625,834 T237S probably damaging Het
Vmn2r43 T A 7: 8,255,327 I296L probably benign Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vps13b T C 15: 35,372,109 probably null Het
Vps13d A G 4: 145,156,137 V962A Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
R7660:Mep1a UTSW 17 43478977 missense probably benign 0.29
R7685:Mep1a UTSW 17 43479174 missense probably benign 0.00
R7703:Mep1a UTSW 17 43478106 missense possibly damaging 0.69
R7871:Mep1a UTSW 17 43479235 missense probably benign 0.33
R8783:Mep1a UTSW 17 43478190 missense probably benign 0.00
R8880:Mep1a UTSW 17 43497917 missense possibly damaging 0.46
RF010:Mep1a UTSW 17 43486235 missense probably damaging 0.99
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Z1176:Mep1a UTSW 17 43477320 missense probably benign 0.08
Z1177:Mep1a UTSW 17 43486297 missense probably damaging 1.00
Z1177:Mep1a UTSW 17 43486306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTATCGTGATCTGCCAAAAG -3'
(R):5'- CGCGTACTAAGAGGCACAGTATC -3'

Sequencing Primer
(F):5'- CTGTTGTTGAAGAAAACTTAAGCC -3'
(R):5'- GTATCCACAGCACGGTCAAAGTTTG -3'
Posted On 2020-06-30