Incidental Mutation 'R8132:Spag16'
ID632046
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70381302 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 483 (Y483C)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425]
Predicted Effect probably damaging
Transcript: ENSMUST00000065425
AA Change: Y483C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: Y483C

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7261:Spag16 UTSW 1 70299621 missense possibly damaging 0.56
R7298:Spag16 UTSW 1 69919426 intron probably null
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
R7598:Spag16 UTSW 1 69870308 missense probably damaging 1.00
R7942:Spag16 UTSW 1 69827088 missense probably benign 0.11
R8047:Spag16 UTSW 1 69842996 missense probably damaging 1.00
R8329:Spag16 UTSW 1 69895248 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCCTCTCTATCGACATATC -3'
(R):5'- TTGTACCCATTACTGAAAGAGAGG -3'

Sequencing Primer
(F):5'- GGGCCTCTCTATCGACATATCTTAAG -3'
(R):5'- TACCCATTACTGAAAGAGAGGTTACC -3'
Posted On2020-06-30